JMD 2005, Vol. 7, No. 3
Copyright © 2005 American Society for Investigative Pathology & Association for Molecular Pathology
Genotyping Microarray for the Detection of More Than 200 CFTR Mutations in Ethnically Diverse Populations
Iris Schrijver*,
Eneli Oitmaa
,
Andres Metspalu
and
Phyllis Gardner
From the Department of Pathology,
*
Stanford University School of Medicine, Stanford, California; Asper Biotech, Ltd.,
Tartu, Estonia; the Institute of Molecular and Cell Biology,
University of Tartu/Estonian Biocentre, Tartu, Estonia; and the Department of Medicine,
Stanford University School of Medicine, Stanford, California
 |
Abstract
|
|---|
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.
 |
Introduction
|
|---|
Cystic fibrosis (CF) is a severe, common autosomal recessive disease due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (OMIM number *602421; http://www.ncbi.nlm.nih.gov/Omim/). Asymptomatic carrier parents, who have no physiological or biochemical outcome that enables routine identification, typically have one CFTR mutation; whereas diseased progeny carry at least two mutations, one on each CFTR gene allele. CF has a high incidence in people of Northern European descent, occurring in approximately 1 in 2500 live births. Because of this, the American College of Medical Genetics and the American College of Obstetricians and Gynecologists (ACMG and ACOG) recently called for CF mutation carrier screening for expecting couples and for those contemplating pregnancy in high-risk groups (Northern European and Ashkenazi Jewish populations) as well as for proper counseling about diagnostic availability and limitations of screening in other groups with lower disease risk.1
By use of the inclusion criterion of mutations having a threshold of 0.1% frequency in the general U.S. population, a routine screening panel of 25 mutations was initially selected from the more than 1300 currently described CFTR sequence variants (http://www.genet.sickkids.on.ca/cftr/). This recommended panel was recently modified and currently includes 23 mutations.2
The selected panel chiefly reflects the mutations prevalent in the high-risk populations of Northern European and Askenazi Jewish descent. Mutations that are prevalent in other races and ethnicities are mostly not included in the routine CF 25 mutation panel because they do not reach inclusion criteria for the general population threshold.
Although development of commercial versions of the recommended screening panel (usually augmented by one to six mutations) has led to on-site CFTR mutation carrier screening, there are serious limitations of the currently available tests for widespread use, chiefly the detection rate, which depends on ethnicity. The risk of CF mutation carrier status varies by ethnicity, with the highest risk in people of Northern European ancestry at 1 in 25 and in people of Ashkenazi Jewish descent at 1 in 29.1, 2
Other populations have discernible risk, however, including Hispanic Americans (1 in 46), African Americans (1 in 65), and Asian Americans (
1 in 90). The latter three estimates may be lower than the actual risk in these ethnicities because of ascertainment bias due to the misperception that CF is a "Caucasian disease." In addition, some ethnic groups (eg, Asians) have not, as yet, been studied at the molecular level as thoroughly as the Caucasian populations. Thus, whereas the current on-site tests can achieve a detection rate of 90% in Northern European Caucasians with CFTR carrier status, the ability to detect CF mutation carrier status in other populations falls off considerably, with the estimated detection rates of 69% in African Americans and 57% in Hispanic CF carriers.1
Currently, if the on-site carrier screening with the recommended panel of CFTR mutations is negative and if there is a family history or anxiety is high, DNA samples may be sent to reference laboratories for more comprehensive analysis that involves significantly higher costs. For non-Caucasians, carrier screening by a larger commercial panel is often preferentially chosen by counselors over the ACMG/ACOG recommended panel because of detection limitations. For diagnostic purposes in suspected CF patients, a carrier screening panel is sometimes used; but in those instances, second tier testing is frequently necessary. This second tier of more comprehensive testing generally involves either larger mutation panels or scanning methodologies, such as differential gradient gel electrophoresis, denaturing high-performance liquid chromatography, temporal temperature gradient gel electrophoresis, or single-strand conformation analysis, followed by direct DNA sequencing to characterize the mutations identified by scanning techniques.3
The gold standard of direct DNA gene sequencing is currently too costly for routine diagnostic use.
In light of the ethnic diversity of the U.S. population and the frequency of ethnically mixed marriages (http://www.census.gov/), we believe that a significantly expanded CF mutation panel, suitable for on-site use, would be beneficial as an option for routine CF mutation carrier screening. This may especially be desirable in non-Caucasians and individuals of mixed ethnicity. We describe a molecular diagnostic assay, using a new use of the arrayed primer extension (APEX) technology4
able to detect 204 different CFTR mutations that include a large number of mutations detected in non-Caucasians as well as those that are frequent in the Caucasian population and in the U.S. population as a whole. The assay is based on single-primer nucleotide extension, first described by Shumaker et al5
in 1996 and subsequently converted to an array format.4
It is a methodology that enables accurate mutation detection in a microarray format. Our CF APEX microarray described herein is suitable for carrier screening as well as molecular diagnosis of affected individuals.
 |
Materials and Methods
|
|---|
Mutation Selection
The 204 mutations on the APEX microarray were selected from the CF Genetic Analysis Consortium (1994) (http//www.genet.sickkids.on.ca) and the literature,6, 7, 8, 9
representing the most frequently screened mutations in Caucasians and those identified as recurring in specific Caucasian and non-Caucasian populations. The full set of mutations is listed in Table 1
. The sequence numbering in this manuscript is according to the CFTR GenBank reference sequence NM_000492 (http://www.ncbi.nlm.nih.gov/GenBank/).9
Oligonucleotide Microchips
Oligonucleotide primers were designed according to the wild-type CFTR gene sequence for both the sense and antisense directions. The 25-bp oligonucleotides with 6-carbon amino linkers at their 5' end were obtained from MWG (Munich, Germany). Most scanning oligonucleotides were designed to scan 1 bp in the wild-type sequence, except in the case of deletions and insertions that have the same nucleotide in the 1-bp direction. In this case, we designed the oligo to extend further into the deletion or insertion to enable discrimination of the nucleotide change. For example: 5'-AGCCTGGCACCATTAAAGAAAATATCAT-3'
F508 S; 5'-TTTCCTGGATTAT-GCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTT-TCCTATGATGAATATAGATACAGA-3';
F508 AS 3'-AA-CCACAAAGGATACTACTTATATC-5' in which A repre-sents a deliberate mismatch to avoid strong secondary structure and CTT represents a deletion of three nucleotides. In case of the normal allele, we expect signals for the sense oligo in the cytosine (C) channel and for the antisense oligo in the adenine (A) channel (C/A). In case of the mutant allele, we will detect signals for the sense oligo in the thymine (T) channel. The signal corresponding to the antisense oligo will also appear in the T channel (T/T).
The microarray slides used for spotting the oligonu-cleotides have a dimension of 24 x 60 mm and are coated with 3-aminopropyl-trimethoxysilane plus 1,4-phenylenedi-isothiocyanate (Asper Biotech, Ltd., Tartu, Estonia). Primers were diluted to 50 µmol/L in 100 mmol/L carbonate buffer, pH 9.0, and spotted onto the activated surface with BioRad VersArray (BioRad Laboratories, Hercules, CA). The slides were blocked with 1% ammonia solution and stored at 4°C until needed. Washing steps with 95°C distilled water (TKA, Toshvin Analytical, Germany) and 100 mmol/L NaOH were performed before the APEX reactions to reduce the background fluorescence and to avoid rehybridization of unbound oligonucleotides to the APEX slide.
Each selected CFTR sequence variant is identified by two unique 25-mer oligonucleotides, one for the sense and one for the antisense strand, although for some mutations, three oligonucleotides are used. On the other hand, fewer than expected oligonucleotides are used in some cases. For example, when different nucleotide substitutions (with a maximum of three) occur at the same nucleotide position, the accurate sequence can be determined using the same pair of detection oligos (sense and antisense). The APEX primers for mutations 3121-2A>G and 3121-2A>T, as an example, are the same, where A represents the location of the mutation under interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A
G,T S; 5'-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3'; CAACAA-TAATTAACACTAACCTCGA 3121-2A
G,T AS. These variables result in a total of 379 oligonucleotides annealed to the microarray slide.
Genomic and Synthetic Template Samples
Where possible, native genomic DNA was collected. Thus, 51 patient or cell line samples with known mutations were evaluated on the chip (Table 2)
. The presence of mutations in commercially available samples (Coriell Cell repositories; http://locus.umdnj.edu/ccr/) was verified in the Molecular Pathology laboratory at Stanford Hospitals and Clinics. Additional samples were obtained from the Molecular Diagnostics Centre of United Laboratories at Tartu University Clinics. Some DNA samples were a generous gift from Dr. Milan Macek, Jr., at Charles University. This set of samples was anonymized. When it was not readily possible to obtain native genomic DNA samples containing the screened mutations, synthetic approximately 50-bp templates were designed according to the mutated CFTR sequence for both the sense and antisense directions and optimized for melting temperature (MWG). In this case, poly(T) tracts were designed at the 5' end to minimize the possibility of the self-extensions and/or self-annealing of the synthetic templates.
Template Preparation
The CFTR gene was amplified from genomic DNA in 30 amplicons. The PCR reaction mixture (50 µl) was optimized with the following: 10x TaqDNA polymerase buffer; 2.5 mmol/L MgCl2 (Naxo, Estonia); 0.25 mmol/L dNTP (MBI Fermentas, Vilnius, Lithuania) (20% fraction of dTTP was substituted with dUTP); and 10 pmol of primer stock, genomic DNA (approximately 80 ng), SMART-Taq Hot DNA polymerase (3 U) (Naxo, Estonia), and sterile deionized water. After amplification (MJ Research DNA Thermal Cycler; MJ Research, Inc., Waltham, MA), the amplification products were concentrated and purified using Jetquick spin columns (Genomed GmbH, Lohne, Germany). In a one-step reaction, the functional inactivation of the traces of unincorporated dNTPs was achieved by addition of shrimp alkaline phosphatase (Amersham Pharmacia Biotech, Inc., Milwaukee, WI), and fragmentation of the PCR product was achieved by the addition of thermolabile uracil N-glycosylase (Epicenter Technologies, Madison, WI) followed by heat treatment.4
APEX Reactions
The APEX mixture consisted of 32 µl of fragmented product, 5 U of Thermo Sequenase DNA polymerase (Amersham Pharmacia Biotech), 4 µl of Thermo Sequenase reaction buffer (260 mmol/L Tris-HCl, pH 9.5, and 65 mmol/L MgCl2) (Amersham Pharmacia Biotech) and 1 µmol/L final concentration of each fluorescently labeled ddNTPs: Cy5-ddUTP, Cy3-ddCTP, Texas Red-ddATP, Fluorescein-ddGTP, (PerkinElmer Life Sciences, Wellesley, MA). The DNA was first denatured at 95°C for 10 minutes. The enzyme and the dyes were immediately added to the DNA mixture, and the whole mixture was applied to prewarmed slides (58°C). The reaction was allowed to proceed for 10 minutes at 58°C, followed by washing once with 0.3% Alconox (Alconox, Inc.) and twice for 90 seconds at 95°C with distilled water (TKA, Germany). A droplet of antibleaching reagent (AntiFade SlowFade; Molecular Probes Europe BV, Leiden, The Netherlands) was applied to the slides before imaging. This process is depicted schematically in Figure 1
.
During assay development, a few of the oligonucleotides designed from the wild-type CFTR sequence failed to perform the APEX reaction. The chief reason for APEX primer failure is the formation of self-annealing secondary structures that fail to hybridize or facilitate self-priming and extension. To obviate this problem, we designed new versions of such primers by incorporating a mismatch or a modified nucleotide at the 5' or internal part of the primer. Such changes can reduce primer self-complementarity without compromising hybridization and primer extension. In the case of secondary structures at the 3' end, which is essential for template annealing and extension, some alternative versions with internal base substitutions can be attempted, but not all work. After our final design of the APEX primers, 184 sequence variants (out of 204 variants at 181 sites) were detected in both of the sense and antisense directions, 7 from only the sense strand (the antisense strand does not work reliably), and 13 from only the antisense strand (the sense strand does not work reliably).
Analysis
The APEX array had four points of data analysis: both the forward and reverse primers are spotted in duplicate. This vastly reduced the possibility of false-positive signal interpretation due to dust particles or other nonspecific reactions and allowed distinction between homo- and heterozygosity. The array images were captured by means of detector Genorama QuattroImager 003 (Asper Biotech) at 20-µm resolution. The device combines a total internal reflection fluorescence-based excitation mechanism with a charge-coupled device camera.4
Sequence variants were identified using Genorama 3.0 genotyping software.
 |
Results
|
|---|
We selected 204 CFTR sequence variants for a comprehensive diagnostic panel to increase CF carrier and disease detection across all racial and ethnic groups (Table 1)
. Sequence variants selected were obtained from the CF Genetic Analysis Consortium (1994) that compiled information from the screening of 43,849 chromosomes and from studies of relatively small-size samples or those isolated to specific ethnic populations (http://www.genet.sickkids.on.ca/cgi-bin/WebObjects/MUTATION). The population frequencies of the included mutations vary considerably according to ethnicity and number of samples screened, but they represent the most common reported mutations across population groups to date. Mutations include several prominent in non-Caucasian backgrounds, including N1303K, 3849 + 10 kb, 2789 + 5G>A, 3876delA, 406-1G>A, R75X, 2055delG>A, and S549N, which are each prevalent in the Hispanic population (personal observation);7, 10, 11, 12, 13
3120 + 1G>A, which is prevalent in the African-American population; and 1898 + 5G>T, which is prevalent in the Chinese population (http://www.genet.sickkids.on.ca/cftr/). The mutations originate from 26 exons (exons 1 to 22, including exons 6a and 6b, 14a and 14b, and 17a and 17b, and exon 24) and from 15 introns (2, 3, 4, 5, 6b, 8, 10, 11, 12, 14b, 16, 17a, 17b, 19, and 20). They include single-nucleotide substitutions, technically the most easy to detect with the APEX reaction, as well as insertions, deletions, including the large 21-kb deletion, which removes exons 2 and 3, and even repeats, such as the 5T/7T/9T repeats important in congenital bilateral absence of the vas deferens (CBAVD). Sample DNA is amplified in 30 amplicons with 29 pairs of PCR primers (Table 3)
encompassing the mutations, with PCR mixtures that include 20% substitution of dUTPs for dTTPs, allowing for later fragmentation with uracil N-glycosylase as described previously.4
The general applicability of a proposed diagnostic will be determined by its clinical relevance, ease of use, low cost, and number of samples that can be processed per run. In general, the entire APEX reaction process, from PCR amplification (2 hours), PCR product purification (20 minutes), DNA fragmentation (1 hour), APEX reaction (15 minutes), to visualization of results (6 minutes) and analysis of results (1015 minutes) can be accomplished in 4 to 5 hours. The time for sample preparation will be minimized in the future with the development of automated sample preparation and analysis. Because all steps leading up to the visualization of results on the QuattroImager can be performed in parallel, the rate-limiting factor in sample analysis will be determined by the number of imagers per test site. At 6 to 7 minutes analysis time per array, the throughput in 8 hours would be approximately 60 to 70 patients per imager unit.
The results allow reliable and reproducible detection of the wild-type (WT) versus mutation sequence at each array position on the APEX CF microarray. The assay is suitable both for screening of CF carriers (one heterozygous mutation in entire array) and for diagnosis of patients (two mutations, either heterozygous at two array sites or homozygous at one array site). Representative results are presented in Figures 2
and 3
. Figure 2
demonstrates results from three patient samples, one each of normal, heterozygous, and homozygous, at the grid position for mutation 2183AA>G, located in exon 13 (R domain). This mutation has a frequency of 2% in a screened sample of 2006 European probands (http://www.genet.sickkids.on.ca/cgi-bin/WebObjects/MUTATION). Figure 3
shows the results from three patient samples at the grid position for the common mutation
F508, again one each for normal, heterozygous, and homozygous at that position. In each case, the results accurately detect the sequence of both alleles for each patient sample. The 5T/7T/9T poly(T) tract polymorphism in IVS 8, of which the 5T variant is particularly important in CBAVD, is the most technically difficult mutation to accurately identify. Differentiation of the poly(T) length requires three sets of APEX primers for accurate detection. Representative results for three patient samples (5T/7T, 7T/9T, and 9T/9T) are presented in Figure 4
. The first set of primers can distinguish between 5T and 7T/9T. The second set can distinguish between 5T and 9T. The third set of primers can distinguish between 7T and 9T. The first two of the three primer pairs present a technical difficulty previously alluded to, ie, despite several attempts to redesign and optimize the allele-specific primer pairs, an APEX oligo does not necessarily function reliably in both directions. Specifically the sense strand for the first primer pair and the antisense strand for the second primer pair are unreliable, and results from these must be disregarded. The antisense strand for the first pair and the sense strand for the second pair provide reliable identification of the probed base sequence, however, in each case. By testing at all three allele-specific oligo pairs for the IVS8 5T/7T/9T site, the length of the T repeat can be accurately and reproducibly determined.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 2. APEX analysis at mutation site 2183AA>G. Each numbered row represents the analysis of an individual patient sample. The row presents two sets of four-channel fluorescent images representing the bases adenine (A), cytosine (C), guanine (G), and thymine (T), respectively for the sense strand (top) and antisense strand (bottom). The histograms to the right of the fluorescent images are of the fluorescent intensities of the four channels at the mutation analysis site. The letters to the right of the histogram represent the base(s) identified on each strand. Row 3 presents the results of heterozygous target DNA derived from a CF patient (WT/2183AA>G). In this case, the sense strand is extended by both the wild-type (WT) complementary target sequence base A and the base G complementary for the mutation, whereas the antisense strand is extended by the WT base T and the base C complementary for the mutation. Row 4 contains the results of normal DNA derived from a non-CF individual at the target sequence (WT/WT), with the expected WT base A in the sense channel and WT base T in the antisense channel. Row 5 contains the results of a homozygous target DNA derived from a CF patient (2183AA>G/2183AA>G), with the base G complementary for the mutation in the sense channel and the base C complementary for the mutation in the antisense channel.
|
|

View larger version (78K):
[in this window]
[in a new window]
|
Figure 4. APEX analysis at mutation site IVS8-5T/7T/9T. Representative results for three patient samples are shown at mutation site IVS8-5T/7T/9T. This challenging mutation site requires three pairs of allele-specific primers for accurate identification. The first set of primers (A) consists of a sense strand that does not work reliably despite several iterations and thus should be discounted and an antisense strand predicted to give base C for 5T (/C) and base A for either 7T or 9T (/A). The second set of primers (B) consists of a sense strand that elongates with a C only for 9T and an antisense strand that extends only with a C only for 5T. Thus the expected results for this set of primers is 5T (/C), 7T (/), and 9T (C/). The third set of primers consists of a sense strand oligo that extends with A for 7T and T for 9T, whereas the antisense strand extends with C for 7T and A for 9T. Thus the expected set of results for the third set of primers is 5T (/), 7T (A/C), and 9T (T/A). Adding the three sets of results together, patient sample 30 can be identified as compound heterozygous 5T/7T, patient sample 31 as compound heterozygous 7T/9T, and patient sample 32 as homozygous 9T/9T.
|
|
The CF APEX microarray was validated in a pilot study by means of 51 patient samples (Table 2)
with different CFTR mutations. Mutation sites in which relevant patient samples could not readily be obtained were tested by means of 136 synthetic primers (Table 4)
, designed as approximately 50-mer oligonucleotides based on the wild-type sequence but incorporating the mutation to be identified. Four sites were tested with patient samples and synthetic template DNA with highly comparable results. With this pilot validation series, sensitivity (TP/TP+FN) was 100%. No false negatives were observed. Specificity (TN/TN + FP) was 100% and no false positives were present. The APEX reactions are entirely reproducible under our testing conditions. Testing at each site occurred from 3 to 20 times with identical results, as long as the following requirements have been met: 1) good quality of the DNA sample; 2) clean PCR products, identified as a single band of expected size on agarose gels; 3) complete fragmentation of the uracil N-glycosylase-treated PCR product; and 4) optimization and validation of the arrayed oligos. The reported results constitute a pilot demonstration of the effectiveness of the APEX approach in CF mutation detection. Complete validation of the CF APEX chip, including true sensitivity and specificity, will require systematic evaluation of patient samples with mutations at each of the array sites, and studies performed in a blinded manner.
 |
Discussion
|
|---|
The CF APEX array system presents a new technology for comprehensive screening for CFTR mutations, one that offers several advantages. It is an integrated system with DNA microarray chip, multiplex primer extension on the array, and fluorescence imaging and data analysis.4, 14
Because of the unprecedented number and selection of mutations on the CFTR array, this CF test has a higher mutation detection capability than assays currently available on-site in diagnostic laboratories. It also more than doubles the number of offered mutations on currently available panels at reference laboratories. The inclusion of mutations that have a higher frequency in specific ethnic populations increases this mutation detection capability for patients affected with cystic fibrosis (who have two mutations), as well as unaffected mutation carriers (who have one mutation). The CF APEX test is specific, reproducible, and technically robust. Test costs (including labor, supplies, and capital equipment) will ultimately depend on the scale of production and deployment, but the costs are clearly within the range of current commercial molecular diagnostic tests. In addition, the APEX system in general is applicable to many other molecular diagnostic tests for genetic and infectious diseases. For example, it has recently been developed for detection of more than 400 mutations in the ABCR (ABCA4) gene associated with five distinct retinal phenotypes15
and for detection of ß-thalassemia and G6PD mutations.16
Thus, it is a "platform" technology that in turn amortizes labor and capital costs.
One concern with any platform that allows screening for a large number of mutations, of which some are rare in the general population, is the approach to quality control. Ideally, a positive control is run for each mutation every time the assay is performed. However, even with the widely used commercial CF screening panels that enable testing for approximately 25 mutations, this approach is prohibitively expensive and impractical. Thus, most laboratories have resorted to the inclusion of only a fraction of the positive controls in each assay so that all controls are assessed on a rotating basis. With the CF APEX array, the inclusion of positive controls is even more challenging because of the large number of mutations on the array and the fact that the majority of these are not commercially available. To perform the assay in a clinical diagnostic setting, native and/or synthetic positive control samples could be pooled for an assessment of the entire mutation list in only a few runs. This, of course, will require optimization to achieve ideal conditions. False-positive samples are avoided through several checkpoints in the assay: 1) a negative sample void of DNA is included in each run; 2) every sample is automatically assessed in duplicate; and 3) every sample, when technically possible, is evaluated in both the forward and reverse direction for direct result confirmation. Because it may remain impractical to obtain genomic DNA for routine quality control of all mutations tested, we expect that the use of synthetic samples may remain necessary. Synthetics are dependent on the correctness of the original sequence reported in the literature and cannot reflect the performance of true test conditions, which include the possibility of genomic polymorphisms at or near the PCR primer sites and differences in PCR efficiency compared with genomic DNA. Thus, an initial full validation with genomic samples will be optimal.
Although the CF APEX array, including the 204 mutations presented herein, improves the mutation detection possibilities of first-line CFTR mutation screening, it is clear that many, if not most, mutations that contribute to CF in Hispanics, African Americans, and Asians remain unknown. It is essential that future research endeavors determine the prevalent mutations in each population, followed by inclusion of newly identified mutations on the CF APEX chip (or other diagnostic tests), so that appropriate genetic counseling and understanding of the pathogenesis and outcomes of CF can be achieved in all ethnic groups. Considering that more than 35 million Hispanic Americans reside in the United States and that this is the fastest growing segment of the population (http://www.census.gov/; http://www.dhs.ca.gov), as well as one with a relatively high carrier frequency, it is imperative that more comprehensive screening routinely be provided. In addition, delayed diagnosis in children with CF can result in more severe health problems and can adversely affect prognosis. Diagnostic delay is more frequently observed in ethnic minorities.17
In addition to CF carrier screening, demand for molecular CFTR gene testing has been growing for another reason as well. It is increasingly recognized that mutations in the CFTR gene play a role in a variety of diseases other than classic CF, including CBAVD,18
chronic pancreatitis,19
disseminated bronchiectasis,20
and allergic pulmonary aspergillosis.21
The CF APEX array can serve as the initial research tool to screen for mutations in these diseases, coupled with other more comprehensive but labor- and capital-intensive technologies if results are negative. As other important disease-contributive CFTR mutations are identified, these can be added to the CF APEX array for routine analysis.
 |
Acknowledgments
|
|---|
We thank Dr. Tiina Kahre (Molecular Diagnostics Centre of United Laboratories, Tartu University Clinics) and Dr. Milan Macek, Jr. (Charles University, Institute of Biology and Medical Genetics, Department of Molecular Genetics, CF Center, Prague, Czech Republic) for the generous contribution of DNA samples.
 |
Footnotes
|
|---|
Address reprint requests to Iris Schrijver, M.D., Department of Pathology, L235, Stanford University Medical Center, 300 Pasteur Drive, Stanford, CA 94305. E-mail: iris.schrijver{at}medcenter.stanford.edu
Supported by Stanford University Fund 1HLP 111 (to P.G.), and by ESF grant 4578 and Estonian Ministry of Research and Education grant 0182582s03 (to A.M.).
Accepted for publication February 28, 2005.
 |
References
|
|---|
- Grody WW, Cutting GR, Klinger KW, Richards CS, Watson MS, Desnick RJ, : Subcommittee on Cystic Fibrosis Screening, Accreditation of Genetic Services Committee, ACMG. American College of Medical Genetics: Laboratory standards and guidelines for population-based cystic fibrosis carrier screening. Genet Med 2001, 3:149-154[Medline]
- Watson MS, Cutting GR, Desnick RJ, Driscoll DA, Klinger K, Mennuti M, Palomaki GE, Popovich BW, Pratt VM, Rohlfs EM, Strom CM, Richards CS, Witt DR, Grody WW: Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel. Genet Med 2004, 6:387-391[Medline]
- Girondon-Boulandet E, Cazeneuve C, Goossens M: Screening practices for mutations in the CFTR gene ABCC7. Hum Mutat 2000, 15:135-149[Medline]
- Kurg A, Tonisson N, Georgiou I, Shumaker J, Tollett J, Metspalu A: Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology. Genet Test 2000, 4:1-7[Medline]
- Shumaker JM, Metspalu A, Caskey CT: Mutation detection by solid phase primer extension. Hum Mutat 1996, 7:346-354[Medline]
- Highsmith WE, Burch LH, Zhou Z, Olsen JC, Boat TE, Spock A, Gorvoy JD, Quittel L, Friedman KJ, Silverman LM, et al: A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N Engl J Med 1994, 331:974-980[Abstract/Free Full Text]
- Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS: Improved detection of CFTR mutations in Southern California Hispanic CF patients. Hum Mutat 2001, 18:296-307[Medline]
- Mercier B, Raguenes O, Estivill X, Morral N, Kaplan GC, McClure M, Grebe TA, Kessler D, Pignatti PF, Marigo C, et al: Complete detection of mutations in cystic fibrosis patients of Native American origin. Hum Genet 1994, 94:629-632[Medline]
- Zielenski J, Rozmahel R, Bozon D, Kerem B, Grzelczak Z, Riordan JR, Rommens J, Tsui LC: Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Genomics 1991, 10:214-228[Medline]
- Wong LJ, Wang J, Woo M, Hsu E, Bowman CM: A novel mutation detected by temporal temperature gradient gel electrophoresis led to the confirmative prenatal diagnosis of a Hispanic CF family. Prenat Diagn 2000, 20:807-810[Medline]
- Wang J, Bowman MC, Hsu E, Wertz K, Wong LJ: A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients. J Med Genet 2000, 37:215-218[Free Full Text]
- Wang J, Bowman CM, Wong LJ: A novel CFTR frame-shift mutation, 935delA, in two Hispanic cystic fibrosis patients. Mol Genet Metab 2000, 70:316-321[Medline]
- Orozco L, Velazquez R, Zielenski J, Tsui LC, Chavez M, Lezana JL, Saldana Y, Hernandez E, Carnevale A: Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 2971G
A). Hum Genet 2000, 106:360-365[Medline]
- Tonisson N, Kurg A, Kaasik K, Lohmussaar E, Metspalu A: Unravelling genetic data by arrayed primer extension. Clin Chem Lab Med 2000, 38:165-170[Medline]
- Jaakson K, Zernant J, Kulm M, Hutchinson A, Tonisson N, Glavac D, Ravnik-Glavac M, Hawlina M, Meltzer MR, Caruso RC, Testa F, Maugeri A, Hoyng CB, Gouras P, Simonelli F, Lewis RA, Lupski JR, Cremers FPM, Allikmets R: Genotyping microarray (Gene Chip) for the ABCR (ABCA4) gene. Hum Mutat 2003, 22:395-403[Medline]
- Gemignani F, Perra C, Landi S, Canzian F, Kurg A, Tonisson N, Galanello R, Cao A, Metspalu A, Romeo G: Reliable detection of b-Thalassemia and G6PD mutations by a DNA microarray. Clin Chem 2002, 48:2051-2054[Free Full Text]
- Spencer DA, Venkataraman M, Weller PH: Delayed diagnosis of cystic fibrosis in children from ethnic minorities. Lancet 1993, 342:238[Medline]
- Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, Nunes V, Ferec C, Estivill X: Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med 1995, 332:1475-1480[Abstract/Free Full Text]
- Pezzilli R, Morselli-Labate AM, Mantovani V, Romboli E, Selva P, Migliori M, Corinaldesi R, Gullo L: Mutations of the CFTR gene in pancreatic disease. Pancreas 2003, 4:332-336
- Pignatti PF, Bombieri C, Marigo C, Benetazzo M, Luisetti M: Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis. Hum Mol Genet 1995, 4:635-639[Abstract/Free Full Text]
- Eaton TE, Weiner Miller P, Garrett JE, Cutting GR: Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis? Clin Exp Allergy 2002, 32:756-761[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Johnson, M. J. Yoshitomi, and C. S. Richards
A Comparative Study of Five Technologically Diverse CFTR Testing Platforms
J. Mol. Diagn.,
July 1, 2007;
9(3):
401 - 407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Schrijver, M. Kulm, P. I. Gardner, E. P. Pergament, and M. B. Fiddler
Comprehensive Arrayed Primer Extension Array for the Detection of 59 Sequence Variants in 15 Conditions Prevalent Among the (Ashkenazi) Jewish Population
J. Mol. Diagn.,
April 1, 2007;
9(2):
228 - 236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Tebbutt, A. James, and P. D. Pare
Single-Nucleotide Polymorphisms and Lung Disease: Clinical Implications
Chest,
April 1, 2007;
131(4):
1216 - 1223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Gardner, E. Oitmaa, A. Messner, L. Hoefsloot, A. Metspalu, and I. Schrijver
Simultaneous Multigene Mutation Detection in Patients With Sensorineural Hearing Loss Through a Novel Diagnostic Microarray: A New Approach for Newborn Screening Follow-up
Pediatrics,
September 1, 2006;
118(3):
985 - 994.
[Abstract]
[Full Text]
[PDF]
|
 |
|