JMD 2005, Vol. 7, No. 2
Copyright © 2005 American Society for Investigative Pathology & Association for Molecular Pathology
B-Cell Clonality Determination Using an Immunoglobulin
Light Chain Polymerase Chain Reaction Method
Reetesh K. Pai*,
Artemis E. Chakerian*,
John M. Binder
,
Mitual Amin
and
David S. Viswanatha*
From the Department of Pathology,
*
Experimental Pathology Laboratory, University of New Mexico; Tricore Reference Laboratories,
Albuquerque, New Mexico; and the Department of Pathology,
William Beaumont Hospital, Troy, Michigan
 |
Abstract
|
|---|
To augment the detection of clonality in B-cell malignancies, we designed a consensus primer
light chain gene (Ig
) polymerase chain reaction (PCR) assay in combination with a consensus primer immunoglobulin heavy chain gene (IgH) PCR assay. Its efficacy was then evaluated in a series of 86 paraffin tissue samples comprising neoplastic and reactive lymphoproliferations. Analysis after PCR was accomplished by 10% native polyacrylamide gel electrophoresis after heteroduplex pretreatment of PCR products and by a post-PCR chip-based capillary electrophoresis analytic method. Overall, 49 of 68 (72%) of mature B-cell neoplasms yielded discrete Ig
gel bands within the predicted size range with no clonotypic Ig
products observed among reactive lymphoid or T-cell proliferations. The application of Ig
PCR improved overall sensitivity from 81% with IgH PCR alone to 90% with combined Ig
/IgH PCR, with this effect being most notable in germinal center-related lymphomas. Sequencing of positive Ig
rearrangements revealed that most rearrangements involved members of the V
1 (40%) and V
2 (34%) gene families along with J
1 (26%), J
2 (23%), and J
4 (51%) gene segments. Involvement of V
pseudogenes was identified in 24% of cases with V
-KDE rearrangements. Our results demonstrate the efficacy of Ig
PCR in improving the detection rate of clonality in B-cell neoplasms and further introduce a novel post-PCR chip-based capillary electrophoresis analytic method for rapid PCR fragment size evaluation.
 |
Introduction
|
|---|
Consensus primer polymerase chain reaction (PCR) amplification of the immunoglobulin heavy chain (IgH) gene complementary-determining region 3 (CDR3) is a routine ancillary diagnostic technique for evaluating clonality in B-cell lymphoproliferative disorders.1, 2, 3, 4
Although PCR methods have the advantage of rapidity and the requirement for minimal sample material (compared to genomic Southern blot analysis), the potential false-negative rate is a considerable shortcoming. A significant proportion of B-cell lymphomas do not demonstrate clonotypic IgH amplification mainly due to suboptimal primer binding, either from a lack of consensus target sequences or target site alteration as a result of somatic hypermutation. Alternative strategies for detecting IgH clonality using consensus primers directed against IgH framework region 2 (FR2) or framework region 1 (FR1) have been described,5, 6, 7
but these approaches are also subject to pitfalls. For example, IgH PCR using FR2 consensus primers may be subject to false-negative amplifications due to the lack of highly conserved sequences among many VH-FR2 regions, necessitating the use of highly degenerate consensus primers. The use of multiple IgH FR1 family-specific consensus primers can achieve a high clonal detection rate, but results in larger sized PCR products that are often not well amplified from paraffin-embedded tissue samples.8, 9
In light of these issues, the immunoglobulin light chain genes can present attractive alternative targets for B-cell clonality determination.
During normal B-cell differentiation, IgH gene rearrangements precede immunoglobulin
light chain (Ig
) gene rearrangements, which in turn occur before immunoglobulin
light chain (Ig
) gene rearrangements.10
For a particular allele, if the Ig
gene rearrangement produces a nonfunctional V
-J
product, the locus may undergo segmental deletion via rearrangement with the downstream
-deleting element (KDE).10, 11, 12
In fact, the vast majority of phenotypic
-expressing B cells and a subset of
-expressing B cells have rearrangements involving the KDE. Similar to V
-J
joinings, KDE-mediated Ig
gene rearrangements occur via recombination signal sequences located in either the J
-C
intron (ie, intron recombination signal sequences) or immediately 3' to the V
gene segments, and these often exhibit junctional diversity with the addition of nontemplated (N) nucleotides. Both V
-J
and KDE rearrangements thus offer additional targets for detection of B-cell clonality by PCR.
To further augment the ability to detect clonal B-cell populations in formalin-fixed, paraffin-embedded diagnostic tissue biopsies, we developed and applied a multiplex PCR approach to detect V
-J
and V
-KDE rearrangements in 68 cases of diverse types of mature B-cell neoplasms, as well as 18 other lymphoid proliferations. We demonstrate that a comprehensive Ig
PCR approach to identify both V
-J
and V
-KDE gene rearrangements significantly augments consensus primer IgH PCR for the detection of B-cell clonality and is suitable for paraffin-embedded tissue sources. This study further provides preliminary data regarding the utility of a post-PCR chip-based capillary electrophoresis (CBCE) analytic method that is capable of superior resolution for amplicon detection and sizing compared to standard gel analysis.
 |
Materials and Methods
|
|---|
Patients and Samples
Paraffin blocks from 68 cases of B-cell neoplasms (25 diffuse large B-cell lymphomas, 13 follicular lymphomas, 10 small lymphocytic lymphomas, 9 mantle cell lymphomas, 8 marginal zone lymphomas, and 3 multiple myelomas), along with 7 Hodgkin lymphomas, 2 peripheral T-cell lymphomas, and 9 reactive lymphoid proliferations were retrieved from the Pathology Departments of the University of New Mexico and William Beaumont Hospitals. All of the samples were clinical diagnostic cases obtained between 2001 to 2003 and were classified using conventional histopathological and clinical criteria in accordance with the World Health Organization classification of hematopoietic neoplasms.13
The histological diagnosis was reviewed in each case by two of the investigators (R.P., D.V.), along with details of available flow cytometry data. This study was approved by the University of New Mexico Human Research Review Committee.
DNA Preparation and Polymerase Chain Reaction Analysis
Genomic DNA from all cases was extracted from formalin-fixed, paraffin-embedded tissue sections, according to the manufacturers directions (DNEasy kit; Qiagen, Santa Clarita, CA) and quantitated by UV absorbance spectrophotometry. Three consensus family-specific V
FR3 region primers (designed to target the V
1 through V
6 gene families of Ig
), one consensus J
primer, and one KDE primer were used based on slight modifications of reported V
-FR3, J
, and KDE sequences.14, 15, 16
Less degeneracy was used in the family-specific V
-FR3 and J
primers at the 3' end compared to previous studies.14, 15, 16
The three forward V
primers were designated as follows: V
I/VI targeting the V
I and V
VI gene families; V
III/IV targeting the V
III and V
IV gene families; and V
II targeting the V
II gene family. One consensus J
reverse primer was designed to target J
I, J
II, J
III, and J
IV genes, and one reverse primer was designed to target the KDE locus. Nucleotide sequences for V
, J
, and KDE primers, as well as the schematics of the Ig
PCR strategy, are depicted in Figure 1
.
The Ig
PCR approach consisted of three different reaction tubes per sample (Figure 1)
. In tube 1, two V
primers (V
I/VI at 10 pmol/reaction and V
II at 20 pmol/reaction) were combined with the J
primer (at 10 pmol/reaction). In tube 2, one V
primer (V
III/IV at 30 pmol/reaction) was combined with the J
primer (at 20 pmol/reaction). In tube 3, two V
primers (V
I/VI at 10 pmol/reaction and V
III/IV at 30 pmol/reaction) were combined with the KDE primer (at 10 pmol/reaction). The primer combinations were arrived at based on preliminary experiments to optimize amplification efficiency and minimize primer interference and nonspecific product generation.
For the Ig
PCR tubes, 200 ng of genomic DNA were subjected to amplification in a reaction mixture containing 1x GeneAmp PCR buffer (Applied Biosystems, Foster City, CA), 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP, 2.5 U of Taq polymerase (Applied Biosystems), and the V
, J
, and KDE primer combinations as designated above, and shown in Figure 1
. A touchdown PCR was used involving a denaturing period of 95°C for 5 minutes followed by eight cycles of 95°C for 30 seconds, 1 minute at 64°C, then decreasing the annealing temperature by 0.5°C each subsequent cycle, and 1 minute extension at 72°C. This was followed by 32 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 72°C for 1 minute, with a final primer extension at 72°C for 5 minutes.
Immunoglobulin heavy chain (IgH) gene rearrangements were amplified by PCR, using consensus oligonucleotide primers for VH-FR3 and JH regions, as previously described.17
For IgH PCR, 400 ng of genomic DNA were subjected to amplification in reaction mixtures containing 1x GeneAmp PCR buffer (Applied Biosystems), 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP, 10 pmol of each primer, and 2.5 U of Taq polymerase (Applied Biosystems). PCR amplification was performed by denaturation at 95°C for 5 minutes followed by 40 cycles of 95°C for 30 seconds, 1 minute at 58°C, and 1 minute at 72°C. This was followed by a final primer extension at 72°C for 5 minutes. In all PCR experiments, genomic DNA from known monoclonal neoplastic B cells and reactive tonsil tissue were included as positive and negative controls, respectively. In addition, no DNA template (blank) controls were included with each sample run to exclude potential contamination. Amplification of a 165-bp segment of the ß-globin gene (forward primer, 5'ACACAACTGTGTTCACTAGC3'; and reverse primer, 5'TGGTCTCCTTAAACCTGTCTTG3') was performed in every sample as an internal control for DNA integrity. An additional larger fragment size ß-globin gene amplification (325 bp) was subsequently performed (same forward primer with reverse primer 5'ATCAGGAGT GGACAGATCC3') in a subset of cases found to be negative for V
-KDE amplification, to verify DNA integrity in this larger amplicon range. For Ig
PCR assay sensitivity determination, serial 10-fold dilutions of DNA from a patient sample positive for an Ig
V
-J
clonal rearrangement were made into tonsil DNA (polyclonal B-cell background). Each dilution was kept at 200 ng of total DNA. PCR amplification was performed as described for standard Ig
PCR.
Gel Electrophoresis of PCR Products
All Ig
PCR products were subjected to a heteroduplex (HDX) procedure, which involved heating the reaction for 5 minutes at 94°C followed by immediate immersion on ice for 60 minutes.18
Ten µl of the Ig
PCR products were then analyzed by 10% nondenaturing polyacrylamide gel electrophoresis (PAGE) in 1x TBE buffer for 40 minutes (Bio-Rad Mini-Protean II system; Bio-Rad, Hercules CA) at room temperature, stained with ethidium bromide, and visualized under UV light. The V
-J
PCR is predicted to amplify rearranged products of
130 to 150 bp, whereas the V
-KDE PCR was expected to amplify products of
250 to 300 bp. IgH PCR products (predicted size range
70 to 140 bp) were analyzed by 10% PAGE, but without HDX pretreatment. Samples with an unequivocal dominant band in the expected size ranges were interpreted as monoclonal, and those with a minimal smear pattern or absence of products were interpreted as polyclonal or negative, respectively. ß-Globin controls were assessed concurrently with Ig
and IgH PCR product gel electrophoresis.
Sequencing Analysis of Ig
PCR Products
To confirm the specificity of amplified Ig
gene rearrangements and determine patterns of gene segment usage, the clonal bands from all positive Ig
PCR cases were sequenced. PCR products were gel purified from 4% agarose gels using the Qiagen gel extraction kit, (Qiagen). The extracted PCR products were directly sequenced in one or both directions with V
, J
, or KDE primers, using the dye terminator method on an ABI 3100 capillary sequencer (Applied Biosystems). The derived sequences were compared to known germline DNA sequences of the Ig
V- and J-regions using the V-BASE (CPE Cambridge, UK; http://www.mrc-cpe.cam.ac.uk/vbase-ok) and BLAST (NCBI/GenBank; http://www.ncbi.nlm.nih.gov/blast) computer programs. Individual positive cases, particularly with similar V
region use, were further compared to each other by pair-wise BLAST nucleotide alignment, to ensure unique sequence identity. From the nucleotide sequence information, data regarding V
and J
gene segment usage in each Ig
-positive case were obtained. These results were compared to established germline frequencies for V
and J
gene segments using
2 statistical analysis.
Product Size Determination by CBCE
Analysis after PCR was also performed by a CBCE analytic method in 29 cases comprising a subset of V
-J
(21 cases) and V
-KDE (8 cases) clonal-positive cases, as well as several PCR-negative cases. For CBCE, the previously heteroduplexed PCR products were analyzed on a model 2100 bioanalyzer using DNA 500 chips (Agilent Technologies, Palo Alto, CA). The 16-well chips were prepared for analysis according to the manufacturers directions and using 1 µl of PCR product per sample. A run time of
40 minutes was required for one complete chip (12 samples total), with real-time software rendering and display of the data. A clonal population was defined in this study as a single peak of greater than 15 relative fluorescence units on the y axis (for a 1-µl PCR product amount), falling in the expected product size range for Ig
amplicons. A low-intensity bell-shaped pattern or lack of products indicated polyclonal or negative results, respectively. The CBCE criteria were derived from our preliminary experience with this platform.19
The fragment size and relative intensity of each Ig
amplicon was compared with HDX-PAGE results.
 |
Results
|
|---|
Evaluation of Patient Samples with Ig
and IgH PCR
The Ig
PCR approach consisted of three different reaction tubes (Figure 1)
to detect both V
-J
and V
-KDE rearrangements. Using this PCR strategy and post-PCR HDX-PAGE analysis, Ig
clonal products could be detected in 72% of mature B-cell non-Hodgkin lymphomas (Table 1)
. In each positive (clonal) case, a discrete band was identified by HDX-PAGE within the expected size range of 130 to 150 bp for V
-J
rearrangements and 250 to 300 bp for V
-KDE rearrangements (Figure 2)
. Larger sized, nonspecific HDX bands were also noted in the V
-J
PCR.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 2. HDX-PAGE detection of Ig gene rearrangement with V -J and V -KDE PCR. A: Representative set of various B-cell lymphoma cases with positive (monoclonal) V -J Ig gene rearrangements (lanes 1 to 7). White arrow indicates expected size region for positive bands ( 130 to 150 bp). Note slight variation in PCR product sizes for each sample. Some higher molecular size, nonspecific amplicons are present in most cases. Lanes 8 and 9 represent reactive (polyclonal) B-cell and water-only (no template) controls, respectively. L indicates the 100-bp size ladder. B: Illustration of V -J and V -KDE PCR in combination with IgH PCR for a representative set of cases as follows: diffuse large B-cell lymphoma (lane 1, IgH; lane 2, V -J ; lane 3, V -KDE), follicular lymphoma (lane 4, IgH; lane 5, V -J ; lane 6, V -KDE), extranodal marginal zone lymphoma (lane 7, IgH; lane 8, V -J ; lane 9, V -KDE), and Hodgkin lymphoma, syncytial nodular sclerosis type (lane 10, IgH; lane 11, V -J ; lane 12, V -KDE). Expected size ranges for PCR products: IgH, 70 to 140 bp; V -J Ig , 130 to 150 bp; V -KDE Ig , 250 to 300 bp. L indicates the 100-bp size ladder. For all samples, DNA integrity was confirmed by amplification of a segment of the ß-globin gene (not shown).
|
|
For Ig
PCR, the highest detection rates were found in diffuse large B-cell lymphomas (76%), small lymphocytic lymphomas (80%), and marginal zone lymphomas (88%). The lowest detection rates were obtained in follicular lymphomas (62%), mantle cell lymphomas (67%), and myelomas (33%) (Table 1)
. The addition of Ig
PCR significantly increased the overall detection of clonality in mature B-cell tumors from 81% (IgH PCR alone) to 90% (combined Ig
/IgH PCR). This effect was most notable in the germinal center-associated lymphomas. For diffuse large B-cell lymphomas, the additional analysis of Ig
rearrangements improved the overall detection rate from 84% with IgH PCR alone to 100% with combined IgH/Ig
PCR (Tables 1
and 2)
. For follicular lymphomas, the additional analysis of Ig
rearrangements improved the overall detection of clonality from 46% with IgH PCR alone to 62% with combined IgH/Ig
PCR (Tables 1
and 2)
. For small lymphocytic lymphoma/chronic lymphocytic leukemia, marginal zone lymphoma, and mantle cell lymphoma, additional analysis by Ig
PCR did not significantly impact the overall detection rate of clonality. Ig
PCR also detected clonal rearrangements in two of seven cases of classical Hodgkin lymphoma, with one of these cases also demonstrating monoclonality by IgH PCR (Table 1)
; these cases were notable for syncytial histological features. No clonal Ig
products were observed in any of the 11 reactive lymphoid proliferations or T-cell lymphomas. The dilutional sensitivity of Ig
PCR was found to be 10%, using DNA from a V
-J
clonal lymphoma case diluted into a polyclonal B-cell background (Figure 3)
.
Examination of the positive Ig
cases revealed that V
-J
rearrangements generally predominated over V
-KDE joinings, with the exception of an equal V
-KDE frequency in follicular lymphomas, and only V
-KDE use in the positive Hodgkin lymphoma and myeloma samples (Table 1)
. The surface light chain expression of 36 mature B-cell lymphomas was known by prior flow cytometric analysis. Of the 23
-expressing B-cell lymphomas, 10 cases (44%) had only a V
-J
rearrangement, 4 cases (17%) had a V
-KDE rearrangement only, 1 case (4%) had both V
-J
and V
-KDE rearrangements, and 8 cases (35%) had no rearrangements detected by Ig
PCR. Of the 13
-expressing B-cell lymphomas, 5 cases (39%) had only a V
-J
rearrangement, 3 cases (23%) had a V
-KDE rearrangement only, 3 cases (23%) had both V
-J
and V
-KDE rearrangements, and 2 cases (15%) had no rearrangements detected by Ig
PCR. These findings are summarized in Table 3
. Of note, DNA samples from Vk-KDE-negative cases were successfully reamplified with primers encompassing a larger segment of the ß-globin gene (325 bp), to ensure that insufficient DNA integrity was not the cause for the negative PCR results (data not shown).
Sequence Data of Ig
PCR for Determination of Vk and Jk Gene Usage
A total of 56 Ig
PCR clonotypic alleles were sequenced. V
and J
gene use was assigned by comparison with known germline sequences using the V-BASE and BLAST computer programs. The prevalence of V
gene families in V
-J
gene rearrangements generally reflected the number of available germline V
gene segments within each family (Figure 4)
. Most V
-J
rearrangements involved members of the V
1 (40%) and V
2 (34%) gene families. There was a significant relative overrepresentation of V
4 gene family usage (14%) when compared to the number of available germline V
4 genes using
2 statistical analysis (P = 0.015,
2 = 5.92). Rearrangements involving V
pseudogenes were not identified in any of the V
-J
rearrangements. For V
-KDE rearrangements, members of the V
1 (35%) and V
2 (29%) gene families were most often used (Figure 4)
. Rearrangements involving V
pseudogenes were identified in 4 of 17 (24%) of the V
-KDE-positive cases and primarily involved V
2 and V
7 pseudogenes. Concerning the J
region, J
1 (26%), J
2 (23%), and J
4 (51%) gene segments were used most frequently (Figure 5)
. However, no involvement of the J
3 segment was observed.
CBCE Evaluation of Ig
PCR Products
CBCE provided highly accurate PCR amplicon sizing in 29 clonal Ig
-positive samples tested, with representative results shown in Figure 6 A to C
. By CBCE, the size range for V
-J
rearrangements was between 120 to 145 bp. An additional nonspecific peak was sometimes identified with V
-J
PCR at
210 bp. By CBCE, the size range for V
-KDE rearrangements was between 260 to 290 bp. PCR-negative samples showed either a minimal polyclonal pattern in the expected size ranges, or no deviation from baseline. The data from CBCE agreed well with HDX-PAGE results. CBCE was also more rapid and provided highly resolved histogram data for clonal results. Dilutional sensitivity of CBCE using the same clonal V
-J
lymphoma sample as in Figure 3
was comparable to HDX-PAGE at 10% detection in a polyclonal B-cell background (Figure 6
; D to F).
 |
Discussion
|
|---|
The recent publication of the European BIOMED-2 consortium underscores the value of using comprehensive PCR primers and multiple antigen receptor gene targets to establish the presence of a clonal lymphoid proliferation.20
Ig
gene rearrangements have been previously studied as additional markers of B-cell clonality.14, 15, 16, 21
Although some investigators have thoroughly characterized the specific nature of V
-J
and V
-KDE rearrangements for use in minimal residual disease detection in B-lineage acute leukemias,14, 21
relatively few efforts have evaluated the potential of using Ig
PCR to augment IgH PCR for B-cell clonality determination in the routine molecular hematopathology laboratory setting.15, 16
Our study is complementary to work from other groups and enhances previous data by investigating a broad range of mature B-cell neoplasms, using a simplified Ig
PCR strategy.
This study is unique in also evaluating the frequency and nature of the KDE (specifically V
-KDE) locus gene rearrangements in a series of commonly encountered mature B-cell malignancies. The addition of V
-KDE analysis is particularly helpful in PCR clonality detection of both
- and
-expressing B-cell lymphomas. In our group of 68 well-characterized mature B-cell neoplasms, application of Ig
PCR alone resulted in the demonstration of clonality in 72% of cases. Significantly, by combining the Ig
and IgH PCR methods, the detection rate for clonality in B-cell lymphomas increased from 81 to 90%, with this effect being most evident among follicular lymphomas and diffuse large B-cell lymphomas. We attribute the relatively high overall rate of IgH clonality observed in this series to selection bias, as well as the inclusion of a relatively pronounced number of small B-lymphocyte neoplasms, which are typically positive in IgH PCR analysis using FR3-JH consensus primers. Both V
-J
and V
-KDE rearrangements were observed in Ig
PCR-positive cases, indicating the utility of the latter locus for clonality determination. Furthermore, comparison of V
-J
and V
-KDE by surface light chain immunoglobulin type demonstrated
locus clonal rearrangements in 85% of
-expressing B-cell lymphomas, emphasizing the broad applicability of this approach. Of note, V
-KDE clonal bands were also detected in two of seven cases of Hodgkin lymphoma, one of which also harbored a clonal IgH rearrangement. Pathological review of these two cases revealed syncytial histology, suggesting that sampling of these tissue areas may have enriched for detection of neoplastic B-lineage Reed-Sternberg cells. Among 18 cases of reactive B-cell proliferations and T-cell lymphomas, none yielded discrete bands with the Ig
PCR. The dilutional sensitivity for this Ig
PCR assay was found to be 10%; although better sensitivity is generally expected with PCR-based methods, this finding is in keeping with the experience of other investigators,20
particularly when using a polyclonal B-cell background diluent. Nonetheless, this level of sensitivity should be considered when analyzing tissues only partially involved by a B-cell lymphoma using Ig
PCR.
Despite substantially improving the overall clonal detection in B-cell neoplasms (when combined with IgH PCR), our Ig
PCR assay is nevertheless associated with a false-negative rate. A number of factors account for this issue and the extensive work of the BIOMED-2 Concerted Action group is also instructive in this regard.20
Firstly, the primer strategy used in our approach was relatively limited compared to the BIOMED-2 protocol for Ig
PCR.20
However, we opted to use a simplified set of primers targeting only V
FR3 regions and fewer total primers, to reduce the complexity inherent in multiprimer PCR techniques. Second, the single consensus J
primer sequence used in our assays was slightly more degenerate, or mismatched against the J
3 gene segment, which may account for the absence of J
3 among the V
-J
gene rearrangements in Ig
-positive cases. This effect, however, should have been mitigated in part by the use of the touch down PCR method as described. Similarly, the consensus J
primer was not homologous with the J
5 gene segment, although this segment is infrequently used overall in V
-J
joinings. Third, we did not use an intron recombination signal sequence region primer to detect a subset of intron recombination signal sequence-KDE
rearrangements known to occur at least in chronic B-cell leukemias.21
Lastly, the Ig
loci may be germline in some
-expressing mature B cells due to rare reversals of the usual, orderly gene rearrangement hierarchy, such that successful
light chain gene rearrangements precede
light chain rearrangements.10, 22
As a technical footnote, the upper limit of the PCR product size range for V
-KDE amplicons approaches 300 bp, which may prove problematic when amplifying this target in samples with excessive DNA degradation, although this situation was not encountered in our study. In short, our Ig
PCR primer strategy sought to minimize complexity in favor of robust and unequivocal amplification results, while accepting a modest compromise in overall detection rate. As is evident from the data in this series of B-cell neoplasms, combined Ig
and IgH PCR substantially improves the overall clonal detection rate, particularly for germinal center-related subcategories of lymphoma. In the cases of follicular lymphoma, the combined overall results, although improved, indicate the need for yet additional evaluation of BCL2/IgH rearrangements to further augment the clonality detection rate.
We assessed 56 cases by direct sequencing to determine the distribution of V
and J
gene families in V
-J
and V
-KDE rearrangements and found the frequency of gene segment use generally reflected their representations in the genome. Most Ig
rearrangements involved members of the V
1 and V
2 gene families, which account for 44% and 39% of functional germline V
genes, respectively.23, 24, 25
In our analysis, there was a statistically significant relative overrepresentation of V
4 gene family usage (14%), which only accounts for
2% of germline V
genes. In keeping with the previous observations of others, V
pseudogenes were not involved in any of the V
-J
rearrangements.23
The distribution of V
gene usage demonstrated in this study is also similar to other published series involving both normal and malignant B cells, with the exception of a comparatively greater degree of V
2 gene prevalence seen in our series.23, 26, 27, 28
The V
2 gene family has been previously shown to be used more frequently than other V
gene segments in nonproductive V
-J
rearrangements.27
The relative prominence of V
2 gene usage seen in our series may thus in part be the result of nonproductive V
-J
rearrangements that favored the more frequent use of the V
2 region. Among these mature B-cell neoplasms, the distribution of J
genes in V
-J
gene rearrangements was similar to other published series involving both normal and malignant B cells,22, 23, 26, 27
with the J
1, J
2, and J
4 gene segments used most frequently. The J
3 segment was not identified in any of our cases; however, at least in normal B cells, this J
gene is only present in
5% of V
-J
gene rearrangements.27
Nevertheless, we cannot be completely certain that the inability to detect J
3 segment rearrangements in our cases represents a statistical artifact of sample size, or inefficient PCR detection due to compromised primer-template homology. Notably, no significant association was identified between subtypes of non-Hodgkin B-cell lymphoma and preferential use of
gene families, although a larger study would likely be needed to adequately address this issue.
The distribution of V
genes in V
-KDE gene rearrangements in mature B-cell neoplasms was also approximately representative of their presence in the genome. Of interest, we documented occasional rearrangements involving V
pseudogene segments (primarily V
2 and V
7 families) in the V
-KDE-positive cases. As noted, the use of pseudogenes does not appear to occur in V
-J
rearrangements in either
- or
-positive B cells, but may occur in V
-KDE joinings, perhaps as a mechanism to exclude unwanted or nonfunctional rearrangements.23, 27
Regardless, the presence of such rearrangements remains a valuable clonotypic marker that can be detected with the PCR primers described in this study.
Finally, although PAGE was used in our cases to evaluate heteroduplexed PCR products, we compared standard PAGE analysis to a CBCE platform, to determine the utility of the latter method in detecting V
-J
and V
-KDE rearrangements. CBCE analysis resulted in superior resolution for amplicon detection and permitted more accurate and rapid molecular fragment sizing than PAGE, with comparable dilutional sensitivity. In conclusion, this study demonstrates that the combined approach of IgH and Ig
gene rearrangement analysis can significantly increase the detection rate of B-cell clonality in mature B-cell lymphomas. Multiplex Ig
PCR followed by HDX-PAGE or CBCE is thus a useful ancillary diagnostic tool for detection of B-cell clonality in formalin-fixed paraffin-embedded tissues.
 |
Acknowledgments
|
|---|
We thank Terry Mulcahy in the Center for Sequencing at the University of New Mexico for his assistance in sequencing of PCR products, Michael Grady for excellent technical assistance in preparation of the manuscript images, and Dr. Sarah Lathrop for help with statistical analysis.
 |
Footnotes
|
|---|
Address reprint requests to David S. Viswanatha, M.D., University of New Mexico Health Sciences Center, Department of Pathology, Biomed Res Facility 337C, 915 Camino de Salud, NE, Albuquerque, NM 87131. E-mail: dviswanatha{at}salud.unm.edu
Accepted for publication November 30, 2004.
 |
References
|
|---|
- Inghirami G, Szalbolcs MJ, Yee HT, Corradini P, Cesarman E, Knowles DM: Detection of immunoglobulin gene rearrangement of B cell nonHodgkins lymphomas and leukemias in fresh, unfixed and formalin-fixed, paraffin-embedded tissue by polymerase chain reaction. Lab Invest 1993, 68:746-757[Medline]
- Lehman CM, Sarago C, Nasim S, Comerford J, Karcher DS, Garrett CT: Comparison of Southern hybridization for the routine detection of immunoglobulin heavy chain gene rearrangements. Am J Clin Pathol 1995, 103:171-176[Medline]
- Diaz-Cano S: PCR-based alternative for diagnosis of immunoglobulin heavy chain gene rearrangement. Diag Mol Pathol 1996, 5:3-9[Medline]
- Medeiros LJ, Carr J: Overview of the role of molecular methods in the diagnosis of malignant lymphomas. Arch Pathol Lab Med 1999, 123:1189-1207[Medline]
- Diss TC, Pan L, Peng H, Wotherspoon AC, Isaacson PG: Sources of DNA for detecting B cell monoclonality using PCR. J Clin Pathol 1994, 47:493-496[Abstract/Free Full Text]
- Segal GH, Jorgensen T, Masih AS, Braylan RC: Optimal primer selection for clonality assessment by polymerase chain reaction analysis: I. Low grade B-cell lymphoproliferative disorders of nonfollicular center cell type. Hum Pathol 1994, 25:1268-1275
- Achille A, Scarpa A, Montresor M, Scardoni M, Zamboni G, Chilosi M, Capelli P, Franzin G, Menstrina F: Routine application of polymerase chain reaction in the diagnosis of monoclonality of B-cell lymphoid proliferations. Diagn Mol Pathol 1995, 4:14-24[Medline]
- Deane M, McCarthy KP, Wiedemann LM, Norton JD: An improved method for detection of B-lymphoid clonality by polymerase chain reaction. Leukemia 1991, 5:726-730[Medline]
- Aubin J, Davi F, Nguyen-Salomon F, Leboeuf D, Debert C, Taher M, Valensi F, Canioni D, Brousse N, Varet B, Falndrin G, MacIntyre EA: Description of a novel FR1 IgH PCR strategy and its comparison with three other strategies for the detection of clonality in B cell malignancies. Leukemia 1995, 9:471-479[Medline]
- van der Burg M, Tumkaya T, Boerma M, de Bruin-Versteeg S, Langerak AW, van Dongen JJM: Ordered recombination of immunoglobulin light chain genes occurs at the IGK locus but seems less strict at the IGL locus. Blood 2001, 97:1001-1008[Abstract/Free Full Text]
- Simniovitch KA, Bakshi A, Goldman P, Korsmeyer SJ: A uniform deleting element mediates the loss of kappa genes in human B cells. Nature 1985, 316:260-262[Medline]
- Beishuizen A, Verhoeven MJ, Mol EJ, van Dongen JJM: Detection of immunoglobulin kappa light chain gene rearrangement patterns by Southern blot analysis. Leukemia 1994, 8:2228-2236[Medline]
- Jaffe ES Harris NL Stein H Vardiman JW eds. World Health Organization Classification of Tumors: Pathology and Genetics of Tumors of Haematopoietic and Lymphoid Tissues. 2001 IARC Press Lyon
- van der Velden VHJ, Willemse MJ, van der Schoot CE, Hahlen K, van Wering ER, van Dongen JJM: Immunoglobulin kappa deleting element rearrangements in precursor-B acute B lymphoblastic leukemia are stable targets for detection of minimal residual disease. Leukemia 2002, 16:928-936[Medline]
- Gong JZ, Zheng S, Chiarle R, De Wolf-Peeters C, Palestro G, Frizzera G, Inghirami G: Detection of immunoglobulin
light chain rearrangements by polymerase chain reaction. Am J Pathol 1999, 155:355-363[Abstract/Free Full Text]
- Diss TC, Liu HX, Du MQ, Isaacson PG: Improvements to B cell clonality analysis using PCR amplification of immunoglobulin light chain genes. J Clin Pathol Mol Pathol 2002, 55:98-101[Abstract/Free Full Text]
- Beaubier NT, Hart AP, Bartolo C, Willman CL, Viswanatha DS: Comparison of capillary electrophoresis and polyacrylamide gel electrophoresis for the evaluation of T and B cell clonality by polymerase chain reaction. Diagn Mol Pathol 2000, 9:121-131[Medline]
- Ranheim EA, Jones C, Zehnder JL: Sensitive detection of clonal immunoglobulin rearrangements in frozen and paraffin embedded tissues by polymerase chain reaction heteroduplex analysis. Diag Mol Path 2000, 9:177-183[Medline]
- Avery AK, Chakerian AE, Magotra A, Bononcini I, Viswanatha DS: Post-PCR chip-based capillary electrophoresis technique for B and T-cell clonality determination. Mod Pathol 2004, 17(Suppl 1):350A
- van Dongen JJ, Langerak AW, Bruggemann M, Evans PA, Hummel M, Lavender FL, Delabesse E, Davi F, Schuuring E, Garcia-Sanz R, van Krieken JH, Droese J, Gonzalez D, Bastard C, White HE, Spaargaren M, Gonzalez M, Parreira A, Smith JL, Morgan GJ, Kneba M, Macintyre EA: Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 2003, 17:2257-2317[Medline]
- Beishuizen A, de Bruijn MAC, Pongers-Willemse MJ, Verhoeven MAJ, van Wering ER, Hahlen K, Breit TM, de Bruin-Versteeg S, Hooijkaas H, van Dongen JJM: Heterogeneity in junctional regions of immunoglobulin kappa deleting element rearrangements in B cell leukemias: a new molecular target for detection of minimal residual disease. Leukemia 1997, 11:2200-2207[Medline]
- Brauninger A, Goossens T, Rajewsky K, Kuppers R: Regulation of immunoglobulin light chain gene rearrangements during early B cell development in the human. Eur J Immunol 2001, 31:3631-3637[Medline]
- Cannell PK, Amlot P, Attard M, Hoffbrand AV, Foroni L: Variable kappa gene rearrangement in lymphoproliferative disorders: an analysis of Vk gene usage, VJ joining and somatic mutation. Leukemia 1994, 8:1139-1145[Medline]
- Meindl A, Klobeck J, Ohnheiser R, Zachau HG: The Vk gene repertoire in the human germ line. Eur J Immunol 1990, 20:1855-1863[Medline]
- Solomon A: Light chains of immunoglobulins: structural-genetic correlates. Blood 1986, 68:603-610[Free Full Text]
- Cox JPL, Tomlinson IM, Winter G: A directory of human germ-line Vk segments reveals a strong bias in their usage. Eur J Immunol 1994, 24:827-836[Medline]
- Foster SJ, Brezinschek H, Brezinschek RI, Lipsky PE: Molecular mechanisms and selective influences that shape the kappa gene repertoire of IgM+ B cells. J Clin Invest 1997, 99:1614-1627[Medline]
- Feddersen RM, Martin DJ, Van Ness BG: The frequency of multiple recombination events occurring at the human Igk L chain locus. J Immunol 1990, 144:1088-1093[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
M. A Catherwood, D. Gonzalez, C. Patton, E. Dobbin, L. Venkatraman, and H D. Alexander
Improved clonality assessment in germinal centre/post-germinal centre non-Hodgkin's lymphomas with high rates of somatic hypermutation
J. Clin. Pathol.,
May 1, 2007;
60(5):
524 - 528.
[Abstract]
[Full Text]
[PDF]
|
 |
|