JMD Association for Molecular Pathology 2008 Annual Meeting
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Merchant, S. H.
Right arrow Articles by Viswanatha, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Merchant, S. H.
Right arrow Articles by Viswanatha, D. S.
JMD 2004, Vol. 6, No. 3
Copyright © 2004 American Society for Investigative Pathology & Association for Molecular Pathology


Consultations in Molecular Diagnostics

Fluorescence In Situ Hybridization Identifies Cryptic t(16;16)(p13;q22) Masked By del(16)(q22) in a Case of AML-M4 Eo

Shakil H. Merchant*{dagger}, Skip Haines{ddagger}, Bryan Hall*, John Hozier*{ddagger} and David S. Viswanatha*{ddagger}

From the Department of Pathology, * University of New Mexico Health Sciences Center, Veterans Administration Medical Center, {dagger} and Tricove Reference Laboratory, {ddagger} Albuquerque, New Mexico

Abstract

We report a patient presenting with acute myeloid leukemia (AML)-M4 Eo, in whom conventional cytogenetic analysis revealed a 46, XY, del(16)(q22) karyotype. Molecular analysis of the bone marrow cells using reverse transcriptase polymerase chain reaction (RT-PCR) identified a CBFß-MYH11, "type A" fusion transcript. However, despite a thorough reevaluation, a balanced chromosome 16 abnormality could not be definitively identified by cytogenetics. Since there exists a small possibility of obtaining a false-positive PCR result, fluorescence in situ hybridization (FISH) analysis using dual-color, break-apart probes for CBFß was performed to elucidate the mechanism of fusion gene formation and thus confirm the RT-PCR results. FISH analysis clearly revealed a cryptic t(16;16), which was probably masked by the del(16)(q22). FISH is the preferred diagnostic procedure to elucidate the CBFß-MYH11 fusion in this situation, and resolves the possibility of both false-positive and false-negative results with RT-PCR technique. Due to the improved prognosis of AML associated with the CBFß-MYH11 fusion compared to AML generally, we recommend the use of FISH for detection of inv(16)/t(16;16)/CBFß-MYH11 in patients with failed, complex, or apparently normal cytogenetics, and in whom the cell morphology indicates the strong possibility of this gene fusion.

Multiple recurrent chromosomal aberrations resulting in the disruption of the core binding factor (CBF) genes have recently been correlated with distinct biological and clinical features of acute myeloid leukemia (AML), resulting in delineation of prognostically important categories of this disease.1 Rearrangements of the CBFß gene define one such prognostically distinct group, which is uniquely associated with, but not restricted to, acute myelomonocytic leukemia with abnormal eosinophils (AML-M4 Eo).2 Rearrangement of the CBFß gene results in a fusion gene CBFß-MYH11 produced by the juxtaposition of bands 16q22 (containing CBFß) and 16p13 (containing MYH11). At the cytogenetic level, this juxtaposition is brought about most commonly by inv(16)(p13;q22) and less commonly by t(16;16)(p13;q22).2

Patients with CBFß-MYH11 AML constitute approximately 10% of all de novo acute myeloid leukemias and have significantly better prognosis as compared with patients with complex chromosomal aberrations or normal karyotype.3 This is especially true for patients who receive intensive post-remission treatment with high-dose cytarabine.4 Consequently, in several treatment protocols, the consolidation therapy of adults with AML has been adapted in a risk-adjusted fashion.5 Patients with CBFß-MYH11 AML may achieve continuous complete remission with chemotherapy, rather than proceeding to autologous or allogenic peripheral stem cell transplantation.5 Therefore, detection of these cytogenetic aberrations is of utmost importance in the risk-adjusted stratification of these AML patients.

Standard karyotypic analysis remains the "gold-standard" for the detection of cytogenetic aberrations. However, both inv(16) and t(16;16) may be subtle, cryptic, or masked by deletions and thus difficult to detect using standard cytogenetic techniques, especially in metaphase spreads showing suboptimal chromosomal morphology. The mRNA transcripts resulting from CBFß-MYH11 gene rearrangement are amenable to detection by reverse transcriptase polymerase chain reaction (RT-PCR); however, there exists a small possibility of false-positive RT-PCR results, which could theoretically arise from false-primed sites or carry-over contamination,5, 6, 7, 8, 9 although the former explanation is controversial.10 Conversely, given the marked heterogeneity of breakpoints in (especially) the MYH11 gene,11 a negative RT-PCR may not exclude the presence of the inv(16)/t(16;16). Hence, in such cases, fluorescence in situ hybridization (FISH) studies can be used to elucidate the mechanism of rearrangement and to corroborate the RT-PCR results. We describe one such case of AML-M4 Eo in which, despite thorough reevaluation after obtaining positive RT-PCR results, we were unable to detect inv(16)/t(16;16) unequivocally by classical cytogenetics. FISH studies were subsequently required to identify a cryptic t(16;16)(p13;q22), which was masked by an apparent del(16)(q22), thus reconciling the discrepant karyotypic and molecular findings.

Case History

A 52-year-old male presented to his local doctor with recent history of fatigue. Physical examination was unremarkable; no lymphadenopathy or hepatospenomegaly was palpable. A complete blood count revealed: hemoglobin, 8.5 g/dl (normal: 14 to 18 g/dl); hematocrit, 23.6% (normal, 42 to 54%); platelet count, 13 x 103/mm3 (normal, 150 to 450 x 103/mm3); and white blood cell (WBC) count, 61 x 103/mm3 (normal, 4 to 11 x 103/mm3) with 60% blasts. Bone marrow aspirate confirmed a morphologically classical acute myelomonocytic leukemia with 19% dysplastic eosinophils (Figure 1A)Go . The patient was treated with conventional chemotherapy regimen and went into hematological remission within 1 month. He maintains his remission status 6 months from the time of diagnosis.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. A: Acute myelomonocytic leukemia with dyplastic eosinophils. Note several myeloid blasts admixed with abnormal eosinophils with large basophilic granules. Inset: Partial karyotype showing del(16)(q22) by G-banding (arrow). B: RT-PCR for detection of CBFß-MYH11 fusion transcripts. Chemiluminescent detection of PCR products hybridized with CBFß internal oligoprobe. Lanes are designated as follows: L, 100 bp size ladder; Pt, patient sample; (–), negative (non-specific RNA) control; W, water blank; (+), positive control for CBFß-MYH11 (ME-1 cell line). Arrow demonstrates a 415-bp amplicon type A CBFß-MYH11 product. C: Dual-color, break-apart FISH: large image of metaphase nucleus showing a fused red/green (yellow) signal on the q arm of one chromosome 16 and a green signal on the other arm, while the chromosome 16 homologue shows only the red signal on one arm, consistent with t(16;16)(p13;q22) [indicated by arrows]. Inset: Interphase nucleus showing a yellow fusion signal (normal configuration), as well as one green and one red signal (abnormal signal). See text for further details.

 
Materials and Methods

Cytogenetics
Cytogenetic studies were performed on bone marrow using short-term unstimulated cultures. Metaphases were G-banded by conventional GTW-banding. Karyotypes were described according to the International System for Cytogenetic Nomenclature (1995).

RT-PCR for CBFß-MYH11 Fusion mRNA
RT-PCR for CBFß-MYH11 transcript was performed essentially as previously described.12 Briefly, total RNA was isolated from cells using the RNeasy method (Qiagen, Santa Clarita, CA), according to the manufacturer’s directions. One µg of RNA was reverse-transcribed from random hexamers in a total volume of 20 µl containing 50 mmol/L KCl, 10 mmol/L Tris (pH 8.4), 5 mmol/L MgCl2, 1 mmol/L dNTP, 50 pmol random hexamer, 1 U/µL RNAsin (Promega, Madison, WI), 5 mmol/L dithiothreitol (DTT), and 100 U Moloney’s murine leukemia virus-RT (MMLV-RT; GIBCO-BRL Life Technologies, Grand Island, NY), under the following conditions: 23°C for 10 minutes, 42°C for 60 minutes, 95°C for 5 minutes, and 4°C hold. A first-round PCR amplification was subsequently performed with 15 µl of cDNA in a total 50 µl reaction volume containing 10 mmol/L Tris, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 µmol/L dNTP, 20 pmol of each primer, and 2.5 U Taq polymerase [Perkin-Elmer/Roche, Branchburg, NJ]). The primer sequences were CBFß (5'-3') GCAGGCAAGGTATATTTGAAGG; MYH11 (5'-3') CTCTTCTCCTCATTCTGCTC. These primers amplify the common type A CBFß/MYH11 fusion with an expected product size of 415 bp; in addition, the less common types D and E transcripts can be detected with these primers (~1.2 kb and 1.4 kb, respectively).12 Five µL of cDNA were used for control amplification of a segment of ß2-microglobulin using primers ß2 mol/L-f (5'-3') GAAAAAGATGAGTATGCCTG; ß2 mol/L-r (5'-3') ATCTTCAAACCTCCATGATG. Following an initial denaturation of 95°C for 5 minutes, cycling parameters were three cycles of 95°C for 30 seconds, 59°C for 45 seconds, and 72°C for 90 seconds, then 30 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 60 seconds, and a final extension step of 72°C for 5 minutes. PCR products were analyzed by electrophoresis in 1.5% agarose gel (Seakem ME; FMC Bioproducts, Rockland, ME), vacuum-blotted on nylon membrane (Pall Biodyne, East Hills, NY), and UV cross-linked. Membranes were subsequently hybridized with a 5' biotinylated internal CBFß sequence oligoprobe (5'-3') ATAGAGACAGGTCTCATCGG, stringently washed and detected by chemiluminescence (ECL System; Amersham Life Sciences, Arlington Heights, IL) on autoradiograph film (Kodak XAR; Eastman Kodak, Rochester, NY).

FISH for inv(16)/t(16;16)
Probes
Commercially available LSI CBFß dual-color, break-apart rearrangement probes (Vysis, Downers Grove, IL) for detection of inv(16)/t(16;16) were used in this study. The probe set consists of a mixture of a 5' CBFß probe labeled with Spectrum red and a 3' CBFß probe labeled with Spectrum green. The 5' CBFß probe is approximately 150 kb and is positioned centromeric to the inv(16) breakpoint region. The 3' CBFß probe is approximately 170 kb and is positioned telomeric to the inv(16) breakpoint and does not extend over the breakpoint.

FISH Assay
Slides prepared for cytogenetic analyses were used for interphase and metaphase FISH. FISH assay was performed according to Vysis, Inc. (Downer’s Grove, IL) protocol. Briefly, 10 µl of hybridization mixture (1 µl probe, 2 µl water, and 7 µl hybridization buffer) was added to the target area on the slide. The slides were cover-slipped and sealed with rubber cement, and the probe was denatured at 73°C for 1 minute using the Hybrite system (Vysis, Inc.). After overnight incubation at 37°C, the coverslips were removed, slides were washed in post-hybridization solutions, and counter-stained with 4, 6-diamidino-2-phenylindole (DAPI) in antifade (Vysis, Inc.). Hybridization signals were visualized using a Leitz Diaplan fluorescence microscope equipped with a triple band-pass filter (FITC/Rhodamine/DAPI). Images were captured with a cooled charge-coupled camera (CCD) and digitally recorded (PowerGene MacProbe software Applied Imaging Corp., Santa Clara, CA). Approximately 200 interphase nuclei and five metaphase spreads were examined and scored.

Evaluation Criteria
The probes used result in a red signal on chromosome 16q22 centromeric to the inv(16) breakpoint and a green signal telomeric to the inv(16) breakpoint. Thus a normal cell (with no break at the inv(16) locus) would result in two fused red/green (yellow) signals. A nucleus containing inv(16) would result in separate red and green signals appearing on opposite arms of the inverted chromosome 16, whereas a nucleus containing t(16;16)(p13;q22) would result in one fused red/green signal on the q arm of one chromosome and a green signal on the other arm of the chromosome 16, while the other chromosome 16 will only contain the red signal on one arm.

Results and Discussion

The chromosomal aberrations leading to CBFß-MYH11 gene fusion are recognized as indicators of relatively favorable prognosis and are now classified as a distinct subgroup of AML.1 The detection of these rearrangements is thus not only important diagnostically, but also crucial for treatment stratification and clinical management of these patients.5 As both inv(16) and t(16;16) are cytogenetically visible, conventional karyotypic analysis remains the "gold standard" and most institutions rely on conventional G-banding technique for their detection. However, both inv(16) and t(16;16) are subtle abnormalities that could be missed in suboptimal quality metaphases or be masked by deletions or variant translocations.

Cytogenetic analysis of the bone marrow sample in our case of AML M4Eo (Figure 1A)Go revealed the following karyotype: 46, XY, del(16)(q22)[13]/46, XY. [7] No inv(16)/t(16;16) was discerned at a microscopic level using the conventional GTW banding (Figure 1AGo , inset). While del(16)(q22) is a recurrent abnormality reported in patients with AML M4Eo, the deletion by itself does not lead to the CBFß-MYH11 fusion and hence these cases would not be associated with the same prognostically favorable clinical outcome.5 In several previous studies, reevaluation of del(16)(q22) after detection of CBFß-MYH11 transcripts by RT-PCR, led to identification of a masked or cryptic inv(16)/t(16;16).5, 13 These studies suggest that although true isolated del(16)(q22) exists, many del(16)(q22) can actually occur concomitantly with and therefore mask an inv(16) or t(16;16). Accordingly, RT-PCR analysis performed on our patient’s leukemia revealed the presence of the common (type A) chimeric CBFß-MYH11 gene fusion transcript (Figure 1B)Go . This finding, in turn, prompted careful review of the cytogenetic data, which still revealed only del(16)(q22). To reconcile this major diagnostic discrepancy, FISH analysis was performed using dual-color, break-apart probes for CBFß. Of the 200 interphase nuclei examined by FISH, 183 nuclei (91.5%) showed one fusion signal, along with one green and one red signal; analysis of five available metaphases showed a green signal on the short arm with a fusion signal on the long arm of one chromosome 16, and only one red signal on the homologous chromosome 16, confirming the presence of a t(16;16)(p13;q22) (Figure 1C)Go .

RT-PCR is a rapid and specific test for identifying the presence of the CBFß-MYH11 abnormality.6, 7, 8, 12, 13 Several studies report the retrospective identification of a "masked" or missed inv(16)/t(16;16) in leukemias with positive RT-PCR results.5, 13, 14, 15, 16, 17 While these studies suggest a higher detection sensitivity of RT-PCR for identifying the CBFß-MYH11, there exists the possibility of false-positive RT-PCR results.5, 9 Indeed, there are instances where false-positive PCR results have been reconciled as negative on repeat evaluation after finding no evidence for inv(16)/t(16;16) by cytogenetics or FISH analysis.5 Although our RT-PCR analysis includes a probe hybridization step to enhance specificity, diagnostic verification by FISH was deemed important in this case, in light of the uninformative karyotype. The complementary FISH analysis in our case clearly revealed translocation of the CBFß gene from one chromosome 16, to the short arm (MYH11 region) of the other chromosome 16, thus elucidating the mechanism of CBFß-MYH11 gene fusion and confirming the RT-PCR results. The apparent del(16)(q22) probably had masked the t(16;16), making identification of the latter lesion difficult despite good quality metaphases.

In summary, our case presentation reinforces the utility of FISH technique for assessing submicroscopic rearrangements that escape conventional cytogenetics. Given the clinical relevance of these tumor-associated genetic rearrangements, both molecular and FISH analyses retain complementary roles in elucidating failed, complex, or apparently normal cytogenetics in patients in which cell morphology indicates the possibility of a prognostically important gene fusion. It is thus prudent to perform additional molecular diagnostic tests (ie, RT-PCR and/or FISH), particularly in cases with classical morphological features and a discordant or unexpected karyotype (eg, deletion of 16q), in which the inv(16) or t(16;16) may be masked.

Footnotes

Address reprint requests to David S. Viswanatha, M.D., University of New Mexico Health Sciences Center, Department of Pathology, BRF Room 337C, 915 Camino de Salud, NE, Albuquerque, NM 87131. E-mail: dviswanatha{at}salud.unm.edu

Accepted for publication February 5, 2004.

References

  1. Brunning RD, Benett J, Matutes E, Head D: Acute myeloid leukemia with recurrent genetic abnormalities. Jaffe ES Harris NL Stein H Vardiman JW eds. World Health Organization Classification of Tumours: Pathology and Genetics of Tumours of Haematopoietic and Lymphoid Tissues 2001:81-87 IARC Press Lyon, France
  2. Le Beau MM, Larson RA, Bitter MA, Vardiman JW, Golomb HM, Rowley JD: Association of an inversion of chromosome 16 with abnormal marrow eosinophils in acute myelomonocytic leukemia: a unique cytogenetic-clinicopathological association. N Engl J Med 1983, 309:630-636[Abstract]
  3. Bloomfield CD, Baer MR, Wurster-Hill D: Prognostic factors for selecting curative therapy for adult acute myeloid leukemia. Leukemia 1992, 6:65-67
  4. Ghaddar HM, Plumkett W, Kantarjian HM, Pierce S, Freireich EJ, Keating MJ, Estey EH: Long-term results following treatment of newly diagnosed acute myelogenous leukemia with continuous-infusion of high-dose cytosine arabinoside. Leukemia 1994, 8:1269-1274[Medline]
  5. Mrozek K, Prior TW, Edwards C, Marcucci G, Carroll AJ, Snyder PJ, Koduru PR, Theil KS, Pettenati MJ, Archer KJ, Caligiuri MA, Vardiman JW, Kolitz JE, Larson RA, Bloomfield CD: Comparison of cytogenetic and molecular genetic detection of t(8;21) and inv(16) in a prospective series of adults with de novo acute myeloid leukemia: a cancer and leukemia group B study. J Clin Oncol 2001, 19:2482-2492[Abstract/Free Full Text]
  6. Ritter M, Thiede C, Schakel U, Schmidt M, Alpen B, Pascheberg U, Mohr B, Ehninger G, Neubauer A: Underestimation of inversion (16) in acute myeloid leukemia using standard cytogenetics as compared with polymerase chain reaction: results of a prospective investigation. Br J Hematol 1997, 98:969-972[Medline]
  7. Rowe D, Cotterill SJ, Ross FM, Bunyan DJ, Vickers SJ, Bryon J, McMullan DJ, Griffiths MJ, Reilly JT, Vandenberghe EA, Wilson G, Watmore AE, Bown NP: Cytogenetically cryptic AML1-ETO and CBFß-MYH11 gene rearrangements: incidence in 412 cases of acute myeloid leukemia. Br J Hematol 2000, 111:1051-1056[Medline]
  8. Mitterbauer M, Laczika K, Novak M, Mitterbauer G, Hilgarth B, Pirc-Danoewinata H, Schwarzinger I, Haas OA, Fonatsch C, Lechner K, Jaeger U: High concordance of karyotype analysis and RT-PCR for CBFß/MYH11 in unselected patients with acute myeloid leukemia: a single-center study. Am J Clin Pathol 2000, 113:406-410[Medline]
  9. Hackwell SM, Robinson DO, Harvey JF, Ross FM: Identification of false-positive CBFß/MYH11 RT-PCR results. Leukemia 1999, 13:1617-1619[Medline]
  10. Langabeer SE, Gale RE, Walker H, Linch DC: Reported cryptic rearrangements of CBFß-MYH11 in acute myeloid leukaemia are not due to false priming of contaminating DNA. Leukemia 2000, 14:944-5.2[Medline]
  11. Liu PP, Hajra A, Wijmenga C, Collins FS: Molecular pathogenesis of the chromosome 16 inversion in the M4Eo subtype of acute myeloid leukemia. Blood 1995, 85:2289-2302[Free Full Text]
  12. Viswanatha DS, Chen I, Liu PP, Slovak ML, Rankin C, Head DR, Willman CL: Characterization and use of an antibody detecting the CBFß-SMMHC fusion protein in inv(16)/t(16;16)-associated acute myeloid leukemias. Blood 1998, 91:1882-1890[Abstract/Free Full Text]
  13. Tobal K, Johnson PR, Saunders MJ, Harrison CJ, Liu Yin JA: Detection of CBFß/MYH11 transcripts in patients with inversion and other abnormalities of chromosome 16 at presentation and remission. Br J Hematol 1995, 91:104-108[Medline]
  14. Dierlamm J, Stul M, Vranckx H, Michaux L, Weghuis DE, Speleman F, Selleslag D, Kramer MH, Noens LA, Cassiman JJ, Van den Berghe H, Hagemeijer A: FISH identifies inv(16)(p13q22) masked by translocations in three cases of acute myeloid leukemia. Genes Chromosomes Cancer 1998, 22:87-94[Medline]
  15. Pirc-Danoewinata H, Dauwerse HG, Konig M, Chudoba I, Mitterbauer M, Jager U, Breuning MH, Haas OA: CBFB/MYH11 fusion in a patient with AML-M4Eo and cytogenetically normal chromosome 16. Genes Chromosomes Cancer 2000, 29:186-191[Medline]
  16. Hernandez JM, Gonzalez MB, Granada I, Gutierrez N, Chillon C, Ramos F, Ribera JM, Gonzalez M, Feliu E, San Miguel J: Detection of inv(16) and t(16;16) by fluorescence in situ hybridization in acute myeloid leukemia M4Eo. Hematologica 2000, 85:481-485[Medline]
  17. Martinez-Climent JA, Comes AM, Vizcarra E, Reshmi S, Benet I, Marugan I, Tormo M, Terol MJ, Solano C, Arbona C, Prosper F, Barragan E, Bolufer P, Rowley JD, Garcia-Conde J: Variant three-way translocation of inversion 16 in AML-M4Eo confirmed by fluorescence in situ hybridization analysis. Cancer Genet Cytogenet 1999, 110:111-114[Medline]



This article has been cited by other articles:


Home page
haematolHome page
A. Pulsoni, S. Iacobelli, M. Bernardi, M. Borgia, A. Camera, N. Cantore, F. Di Raimondo, P. Fazi, F. Ferrara, F. Leoni, et al.
M4 acute myeloid leukemia: the role of eosinophilia and cytogenetics in treatment response and survival. The GIMEMA experience
Haematologica, July 1, 2008; 93(7): 1025 - 1032.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Merchant, S. H.
Right arrow Articles by Viswanatha, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Merchant, S. H.
Right arrow Articles by Viswanatha, D. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS