| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Clinical Micro Sensors Division of Motorola, Inc., Pasadena, California
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We report here (and in Terbrueggen RH, Vielmetter J, Chen Y-P, Millan KM, Mucic RC, Olsen GT, Swami N, Umek RM, Wang H, Welch TW, Yowanto H, Yu CJ, Blackburn GF, and Kayyem JF, submitted for publication) the development of a novel electronic detection format for nucleic acids that utilizes inexpensive instrumentation including a disposable DNA chip.4 Signaling probes containing ferrocene moieties,5 redox active metal centers that facilitate the detection of nucleic acid targets in homogeneous assays that eliminate the need for separate labeling and washing steps, form the basis of this electronic detection platform. We demonstrate here that the electronic detection platform facilitates sequence-specific detection of amplicons, mismatch discrimination for the characterization of single nucleotide polymorphisms (SNPs), and gene expression monitoring. The versatility of the electronic detection platform makes it suitable for multiple applications in molecular diagnostics and pharmacogenetics.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Synthesis of DNA Capture Probes and Signaling Probes
DNA capture probes were prepared by solid phase synthesis using an
alkane chain of 16 residues terminated with a thiol (abbreviated C16S)
as substrate after attachment to a controlled pore glass support. The
probes were synthesized 3' to 5' such that the 5' end is in solution
and the 3' end in the SAM (Figure 1A)
.
The capture probes synthesized are shown in Table 1
. Signaling probes (Table 2)
were synthesized with modified adenine residues that have a ferrocene
substitution on the ribose ring.6
Probes are designed such
that signal and capture probes are complementary to adjacent regions of
the target.
|
|
|
.
|
The AC voltammetry technique used to gather the electrochemical signal at the DNA sensor is described in more detail elsewhere4, 5 (Terbrueggen RH, Vielmetter J, Chen Y-P, Millan KM, Mucic RC, Olsen GT, Swami N, Umek RM, Wang H, Welch TW, Yowanto H, Yu CJ, Blackburn GF, and Kayyem JF, submitted for publication). A DC voltage bias is applied to the electrode and ramped, typically from -100 to +500 mV, over a range of electrical potentials that encompasses the redox potential of the ferrocene moiety. An AC voltage of 25 or 100 mV is applied in conjunction with the DC bias to increase the frequency of the redox reaction, thus amplifying the signal. At the redox potential of the ferrocene, the peak of the faradaic current is directly proportional to the number of ferrocene moieties immobilized at the electrode surface that is, in turn, proportional to the number of target nucleic acid molecules. (Faradaic current is that current specifically generated as a result of reduction or oxidation of the ferrocene label.) The total current from the cell passes through microelectronics devices used to detect and measure the electrical signal generated.
Amplification Reactions
Nucleic Acids
Anonymized human genomic DNAs characterized for ACE and
Hfe genotypes were gifts of Dr. Wayne Grody (UCLA, Los
Angeles, CA) and Karl Voelkerding (University of Wisconsin,
Madison, WI), respectively. The template for the HIV
gag DNA amplification was plasmid
V103[lowhy]4,7
an M13-based plasmid containing the
entire HIV sequence. To genotype the Hfe samples, 50 to 200
ng of human genomic DNA were amplified by asymmetric polymerase chain
reaction (A-PCR) with the forward primer in fivefold excess over the
reverse primer and the total primer concentration adjusted to 720
nmol/L. Primers for Hfe A-PCR were: 5'TGGCAAGGGTAAACAGATCC3'
(forward) and 5'CTCAGGCACTCCTCTCAACC3' (reverse).
PCR Reagents
Deoxynucleotide 5'-triphosphates, 10x PCR buffer, 25 mmol/L
MgCl2, and Taq polymerase were
purchased and used according to the supplier’s recommendation (Applied
Biosystems, Foster City, CA).
PCR and A-PCR
PCR of ACE type D DNA was carried out using various amounts of
human genomic DNA (12.5–200 ng), 200 µmol/L dNTP, 50 mmol/L KCl, 10
mmol/L Tris-HCl (pH 8.3), 2 mmol/L MgCl2, 0.25 U
Taq polymerase, and 300 nmol/L forward and reverse primer.
Cycling parameters were 94°C for 3 minutes to denature human DNA,
followed by 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds,
and 72°C for 45 seconds, and ending at 72°C for 5 minutes to extend
all unfinished DNA ends. The ACE type D DNA amplicon (191 bp) was
confirmed by gel electrophoresis alongside molecular weight standards
and by ApoI restriction enzyme digestion and subsequent gel
electrophoretic analysis. A-PCR8
differed from PCR in that
forward (5'CTGGAGACCACTCCCATCCTTTCT3') to reverse primer
(5'GATGTGGCCATCACATTCGTCAGA3') concentration was 5:1 and total primer
concentration was 720 nmol/L.
Reverse Transcriptase (RT)-A-PCR for Gene Expression Monitoring
RNA Preparation
Total white blood cell RNA was isolated using the Qiagen RNA
Easy kit. RNA integrity was assessed by formaldehyde gel
electrophoresis followed by ethidium bromide staining and rRNA
visualization (not shown). Human heart RNA was purchased from Ambion,
(Austin, TX).
Reverse Transcription
cDNAs were synthesized using Retroscript (Ambion) according
to the supplier’s recommendation. One to 2 µg of total white blood
cell RNA was mixed with 4 µl dNTP (10 mmol/L), 2 µl primers (random
decamer), and H2O to a volume of 16 µl. The
sample was heated for 3 minutes at 70°C and then chilled on ice. One
microliter of Moloney murine leukemia virus reverse transcriptase (100
units), 2 µl reaction buffer (10x), and 1 µl RNasin (10 units)
were added to the sample, followed by incubation at 42°C for 1 hour
for cDNA synthesis. Reverse transcriptase was then inactivated at
92°C for 10 minutes and cDNAs were stored at -20°C.
A-PCR of cDNAs
Using the cDNA as input, A-PCR was performed using primers
specific for actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH),
and the apoptosis-related genes fas, p53,
p21, bax, and bcl-2. The
gene-specific primers were purchased as a set (Stratagene, San Diego,
CA). Reactions were conducted with 1 to 3 µl of cDNA solution, 200
µmol/LdNTP, 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 2 mmol/L
MgCl2, and 0.25 U Taq polymerase,
using 600 nmol/L forward primer and 120 nmol/L reverse primer. A-PCR
cycling parameters were 94°C (2 minutes), followed by 35 cycles
(94°C for 45 seconds, 58°C for 1 minute, and 72°C for 1 minute),
and ending with 72°C for 5 minutes to extend unfinished DNA ends.
Amplicons of actin (400 bp), GAPDH (600 bp), fas (550 bp),
p53 (431 bp), p21 (561 bp), bax (365
bp), and bcl-2 (293 bp) were confirmed by gel
electrophoresis, as above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. The SAM
contains three species of molecules including DNA capture probes with
alkane linkers, polyglycol-terminated alkane chains that serve as
insulators for the sensor, and highly conjugated phenylacetylene
molecular wires, that provide a pathway for electron transport between
labeled probe and the gold electrode4, 5
(Terbrueggen RH,
Vielmetter J, Chen Y-P, Millan KM, Mucic RC, Olsen GT, Swami N, Umek
RM, Wang H, Welch TW, Yowanto H, Yu CJ, Blackburn GF, and Kayyem JF,
submitted for publication). The DNA capture probes assemble in the SAM
by virtue of the alkane linker at the 3' end of the DNA strand. All of
the molecules have a thiol group that, on deposition, results in a
sulfur-gold bond that immobilizes the molecules on the gold surface.
The illustration is simplified inasmuch as the ethylene glycol heads
are likely not ordered when present in the SAM,9
and the
SAM is likely less ordered in the presence of the molecular
wires.10
When target nucleic acid is present, sequence-specific hybridization to
the capture probe occurs at the electrode surface (Figure 1A)
. The
target participates in a second sequence-specific hybridization
reaction with a signaling oligonucleotide that is labeled with
ferrocene moieties that act as reporter molecules. In most cases, the
region of signaling probe hybridization is immediately proximal to the
region of capture probe hybridization on the target. The signaling
oligonucleotide is modified through the incorporation of multiple
ferrocene-modified phosphoramidites during synthesis. Ferrocene is a
redox-active metal compound. When a given potential is applied to the
gold electrode, electron transfer occurs between the ferrocene and the
gold electrode (Figure 1B)
. Target-specific electrodes can be
engineered by varying the sequence of the deposited DNA capture probe.
In the chip configuration described in this report, 14 electrodes are
arrayed on a chip along with reference and auxiliary electrodes to
complete the electrochemical cell. A polycarbonate cartridge containing
inlet and outlet ports houses the electrodes in a hybridization chamber
while the connector edge remains exposed such that the chip can be
analyzed in an electrochemistry workstation. Devices more amenable to
use in the molecular diagnostics laboratory have been developed and
will be described elsewhere.
We fabricated an electrode array containing capture probes specific for
sequences in the human immunodeficiency virus (HIV) or hepatitis C
virus (HCV) on separate electrodes. We synthesized an oligonucleotide
co-linear with a portion of HIV to serve as a target mimic. A
ferrocene-labeled signaling probe was synthesized that is complementary
to the HIV target in the sequence immediately adjacent to the region of
complementarity to the capture probe. A ferrocene-labeled signaling
probe complementary to HCV was also synthesized. The HIV target mimic
and both signaling probes were introduced into the hybridization
chamber, and the electrodes were interrogated electronically and their
signal outputs recorded. Representative voltammograms from HIV- and
HCV-specific electrodes demonstrate fundamental properties of the
system (Figure 1C)
. Both electrodes exhibit a background current,
arising from the capacitance of the electrode-solution interface, of
approximately 180 nA at -100 mV that rises to approximately 240 nA at
500 mV. However, only the electrode containing HIV capture probes also
exhibits a specific faradaic current. Thus, there is no detectable
faradaic current from the HCV-specific electrodes despite the fact that
the HCV signaling probe is present. We reason that sequence-specific
hybridization of the HIV target mimic facilitates the formation of a
structure similar to that depicted in Figure 1A
only on the electrodes
modified with HIV-specific capture probes. Moreover, only signaling
probes immobilized in the ternary complex are electronically coupled to
the electrode and thus capable of generating a signal, an observation
consistent with development of one-step detection protocols that do not
require steps to remove unbound signaling probes (see below).
Amplicon Detection on the Electrochemical Sensor
The utility of the electrochemical sensor for sequence-specific
detection of amplicons was explored. As an example, we examined an
insertion/deletion polymorphism in intron 16 of the angiotensin
converting enzyme (ACE) gene that results from
the presence (allele I) or absence (allele D) of an Alu
sequence. The polymorphism has been studied for correlation with
various aspects of cardiovascular disease.11
A 192-bp
fragment of the D allele was amplified from genomic DNA. We synthesized
a 22-bp capture probe homologous to the D allele and a
ferrocene-labeled signaling probe complementary to an adjacent 22 bp of
the D allele. Also, a 74-mer oligonucleotide, co-linear with a portion
of the D allele and encompassing the capture and signaling probe
annealing regions, was synthesized to serve as a target mimic (Figure 2A)
. The sister strand to the 74-mer target mimic was also synthesized.
Electrode arrays were prepared that contained capture probes
complementaryto the target strand of the ACE D allele. The arrays also
contained negative control electrodes modified with an unrelated,
heterologous DNA capture probe. ACE electrode arrays were challenged
separately with ACE amplicon or single- or double-stranded target
mimics. In each hybridization reaction, the same ferrocene-labeled
signaling probe was also present.
|
at room
temperature. Only hybridization solutions containing the ACE amplicon
or a target mimic generate a signal above the background. Notably, the
single-stranded oligonucleotide target mimic generates considerably
more electrochemical signal than the amplicon or the double-stranded
model target. This observation suggests that, despite initial heat
denaturation, amplicon sister strand re-annealing in solution competes
with hybridization to the capture probes at the DNA sensor.
To test the hypothesis that sister-strand re-annealing inhibits
amplicon detection, we introduced strand bias into the PCR product by
performing a modified A-PCR. A-PCR D allele products were used to
challenge arrays containing electrodes with capture probes homologous
to the D and I alleles. After 20 minutes of hybridization at room
temperature, the D allele amplicon generated signals specifically on
electrodes modified with D capture probes, whereas the electrodes
modified with I allele-specific capture probes did not generate
detectable signals (Figure 2C)
. In this amplicon detection protocol, an
aliquot of the amplification reaction is simply diluted into
hybridization/electrochemical detection buffer containing signaling
probes and introduced into the hybridization chamber. Thus, the
electronic detection platform facilitates sequence-specific detection
of amplicons in a single-step, homogeneous assay. Amplicons generated
with the strand displacement amplification technique12
are
also readily detected with the electronic detection platform (not
shown).
Single-Base Mismatch Discrimination on the Electrochemical Sensor
Next, we investigated whether discrimination of single-base
mismatches among amplicons is feasible with the system. We synthesized
a 76-mer oligonucleotide co-linear with a portion of the HIV genome to
serve as a target mimic. We synthesized a second 76-mer containing a
single G to C transition at position 32 from the 5' end of the
oligonucleotide, centered in the region of the target complementary to
the capture probe. For ease of reference, we have designated the
original 76-mer as wild-type (WT) and the oligonucleotide containing
the substitution as mutant. Both 76-mer oligonucleotides are perfectly
complementary to the signaling probe synthesized and are anticipated to
form similar sandwich structures (Figure 1A)
under non-stringent
conditions.
We prepared electrode arrays with capture probes perfectly
complementary to the WT HIV oligonucleotide target mimic. The WT and
mutant targets were both introduced into these chips and, after an
initial hybridization at ambient temperature, the electrochemical
signal on the electrodes was characterized at various temperatures. As
the temperature in the hybridization chamber is increased, the faradaic
peak current is retained preferentially on electrodes occupied by
targets that are perfectly matched (Figure 3A)
. Thus, SNPs are discriminated on the electronic detection platform by
virtue of their differential stability at elevated temperature. We
prepared a genotyping chip containing subsets of electrodes that are
perfectly complementary to the WT or mutant HIV oligonucleotide target
mimics. The arrays also contain capture probes that are not
complementary to either target to serve as controls for nonspecific
binding. At the elevated temperature, samples containing only one type
of target exhibit a preferential reduction in the electrochemical
signal from the electrodes that have capture probes mismatched with the
target (Figure 3B)
. In contrast, arrays challenged with a mixture of
the two targets exhibit a similar amount of signal from the two types
of electrodes at elevated temperature (Figure 3B)
. In an effort to
normalize the signal output with respect to variation on the
electrodes, we defined the signal output at 25°C for each electrode
in the array as 100%. Using the normalized data, a simple pattern
emerges for the characterization of the SNP. The normalized signal
output is always more than twofold greater (usually 3- to 15-fold) on
the electrodes containing capture probes that are perfectly matched
compared to electrodes containing mismatched capture probes for
amplicons derived from homozygous samples. In contrast, the normalized
signal output is less than 1.5-fold different between the two kinds of
electrodes for heterozygous samples.
|
. The probes were designed
such that mismatches between the WT capture probe and the mutant
sequence (and vice versa) occur in the middle of the capture
probe. We also synthesized a common signaling probe and a pair of
target mimics, co-linear with the WT and mutant amplicons,
respectively. The optimal temperature at which to discriminate between
the two targets was defined using target mimics (not shown). Next,
amplicons harboring the SNP were prepared, using the A-PCR technique
from patient DNAs previously characterized as homozygous WT, homozygous
mutant, or heterozygous. Two patient samples of each genotype
were studied. The amplicons were analyzed independently using electrode
arrays containing WT and mutant C282Y capture probes. The A-PCR
products can be readily genotyped using the normalized signal output at
the stringent temperature (Figure 3D)
. Specifically, the A-PCR products
from the three different genotypes result in three distinct ratios of
WT to mutant electrode signals. Thus, the electronic detection platform
described here can be readily used to genotype DNA samples.
Gene Expression Monitoring through Electronic Detection
To explore the utility of a gene expression monitoring chip we
chose the cellular apoptotic response as a model. Several gene products
are known to be up- or down-regulated during apoptosis.14
We chose to characterize 5 apoptosis-regulated genes fas, p53,
bax, p21, and bcl-2, and actin or
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as control
genes. In the electrode array, each gene has two corresponding
electrodes with cognate capture probes, an additional two electrodes
are dedicated to the detection of the control gene, and two electrodes
are modified with an unrelated DNA capture probe to monitor nonspecific
signaling.
We designed capture and signaling probes in such a way as to minimize
the chance of direct interaction between signaling probes and capture
probes and cross-hybridization between amplicons and unrelated capture
probes for the genes listed. No direct interaction between the
signaling probes and capture probes was detected (not shown).
Oligonucleotides were synthesized to serve as target mimics during the
characterization and optimization of the apoptosis gene expression
monitoring chip. When electrode arrays are challenged with the
bcl-2 target mimic and its cognate signaling probe, the
electrodes modified with the bcl-2 capture probe generate a peak
faradaic current that is more than 100-fold greater than that detected
on any other electrode type (Figure 4A)
. When the same DNA chip is subsequently challenged with a pool of the
remaining target mimics and their cognate signaling probes, all of the
electrodes generate faradaic current (Figure 4A)
. Similar results were
obtained when bax was used as the target of interest (Figure 4B)
. The amount of peak faradaic current observed varies among the
electrodes with respect to capture probe type (Figure 4A
and 4B)
.
Although the source of this variation is unknown and is under
investigation, we have been able to design alternative capture and
signaling probe pairs for poorly performing sets, and we have realized
nearly equivalent performance among various probe sets, eg, ) (Figure 4A
versus Figure 4D
. Results similar to those shown in
Figure 4
, A and B, were obtained for all of the target mimics studied
including p53, p21, fas, actin, and GAPDH (not shown).
|
. Moreover, the signal detected on electrodes
other than fas is likely a consequence of non-specific
binding of signaling probes, since similar signals are observed from
the sample that lacked reverse transcriptase (Figure 4C)
. The
fas-specific signal detected is, in general, lower than that
observed from single-strand oligonucleotide target mimics (Figure 4C
versus Figure 4
, A and B), an observation consistent with
the notion that sister-strand re-annealing reduces the amount of target
strand that can be captured on the electrode surface (Figure 2B)
.
Similar to the results obtained with fas, the p53-specific
reaction results in electrochemical signaling almost exclusively from
electrodes modified with p53 capture probes in arrays exposed to
products from a reaction that contained reverse transcriptase (Figure 4D)
. Notably, the signal output for the p53 amplicon in greater than
that observed for the fas amplicon (Figure 4D
versus Figure 4C
). Agarose gel electrophoresis of the two amplicons followed by
ethidium bromide staining confirmed that the p53 amplicon was more
abundant in the samples (not shown). Thus, the gene expression
monitoring chip can be a quantitative indicator of transcript
abundance.
We next explored the possibility that RT-A-PCR reactions could be
pooled to facilitate multiplex gene expression monitoring using the
electronic detection platform. We performed RT-A-PCR using fas- and
GAPDH-specific primers in separate reactions. The reaction products
were combined, diluted with hybridization/electrochemical detection
solution, and introduced into the apoptosis gene expression monitoring
chip. The electrodes containing fas and GAPDH capture probes were the
only electrodes to generate detectable faradaic current (Figure 4E)
.
The signal generated by the fas amplicon in the multiplex analysis is
lower than that seen when fas was analyzed individually (Figure 4E
versus Figure 4C
). However, less RT-A-PCR product was used
and the hybridization time was shorter in the multiplex analysis. Our
findings demonstrate that multiple gene expression products can be
analyzed simultaneously with the electronic detection platform
described here.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
electronically couples ferrocenes in the
signaling probe to the gold electrode. The exquisite sensitivity of the
sensor to the position of the reporter molecule eliminates the need for
washing steps. For example, the PCR amplicons studied here were simply
diluted into hybridization buffer and introduced into the hybridization
chamber of the arrays with excess signaling probe (Figures 2
3
4)
. No
additional steps were required to clean up the reaction products or
eliminate reaction constituents or excess signaling probe before
electronic detection was conducted.
Using the sensor, we achieve single-base mismatch discrimination
(Figure 3)
by empirically determining a temperature at which formation
of a sandwich complex between a mismatched target and capture probe is
inhibited significantly compared to a perfectly matched target. We
assume that destabilization of the signaling complex at the electrode
containing the mismatch is a result of melting of the target and the
capture probe. Such an interpretation is consistent with the observed
destabilizing effect of mismatches on DNA hybrids studied in
solution15
and on solid supports.16
However,
actual melting of the target strand and the capture probe may not be a
prerequisite for signal diminution, since the DNA sensor exhibits
critical distance dependence for electronic coupling of the ferrocenes
in the signaling probe and the electrode.
Our ability to detect different targets specifically at individual
electrodes makes the electronic detection platform readily compatible
with multiplex analyses. Careful selection of capture probes and
signaling probes facilitates detection of multiple nucleic acid targets
at electrodes modified with their respective capture probes even at
ambient temperature (Figure 4E)
. Multiplexing is accomplished without
the need to incorporate a label into the target, eg, fluorescent or
isotopic, by virtue of the sandwich assay. Thus, amplification products
containing naturally occurring nucleotides (Figures 2
3
4)
as well as
unmodified DNA and RNA (unpublished observations) serve as targets for
multiplex analysis in the electronic detection platform. The multiplex
detection capability of the electronic platform combined with one-step
characterization of amplicons makes the system suitable for gene
expression monitoring (Figure 4)
.
Another feature of the platform described here is the ability to
interrogate the biosensor repeatedly without signal decay (Figure 4)
.
Several advantages emerge from this feature. First, mismatch detection
is facilitated. Samples are annealed to electrodes containing capture
probes at ambient temperature. Subsequently, the hybridization solution
is heated and the electrodes interrogated as often as necessary to
survey all of the array’s electrodes. In fact, we have surveyed up to
four SNPs using three temperatures and repeated electrode scanning
(unpublished results). The ability to interrogate electrodes repeatedly
during hybridization facilitates kinetic analysis of target
accumulation at the biosensor surface (Terbrueggen RH, Vielmetter J,
Chen Y-P, Millan KM, Mucic RC, Olsen GT, Swami N, Umek RM, Wang H,
Welch TW, Yowanto H, Yu CJ, Blackburn GF, and Kayyem JF, submitted for
publication). Second, the electronic detection platform is inexpensive
to manufacture.4, 5
The use of exposed gold electrodes on a
printed circuit board exploits existing industry protocols to prepare
the solid support. In addition, the nucleic acid constituents of the
monolayer as well as the signaling probes are readily prepared by
conventional solid-phase synthesis.6
The biosensor is
prepared through the self-assembly properties of the DNA capture probe
and the other constituents of the SAM. The relatively low manufacturing
costs associated with the platform encourage the development of
applications that will benefit from a disposable nucleic acid chip.
The bioelectronic detection platform described here, based on disposable DNA chips and electronic readers, will facilitate the development of relatively low-cost, arrayed nucleic acid-based tests. The arrays will have clinically appropriate densities compatible with the needs of molecular diagnostics laboratories. Moreover, labor costs for molecular diagnostics tests may be decreased by multiplex detection and the elimination of steps after amplification.
In its current design, this bioelectronic detection format remains dependent, in most but not all cases, on some form of in vitro nucleic acid amplification. It is, therefore, currently a system best suited for use in the hospital, university-based, or reference molecular diagnostics laboratory. The system is also being developed for non-human applications such as animal husbandry, transgene detection in commercially important crops, and veterinary infectious disease diagnostics. In both human and non-human applications one can imagine the need for both benchtop, laboratory-based instruments (electronic readers) and more portable, potentially field-deployable units that accommodate the kind of DNA chips described here. More portable systems would require integration of specimen preparation, amplification and electronic detection, areas of research intensively being studied here. The potential also exists for enhancements in the system that may eventually obviate the need for nucleic acid amplification.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Accepted for publication February 21, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  J. C. Liao, M. Mastali, Y. Li, V. Gau, M. A. Suchard, J. Babbitt, J. Gornbein, E. M. Landaw, E. R.B. McCabe, B. M. Churchill, et al. Development of an Advanced Electrochemical DNA Biosensor for Bacterial Pathogen Detection J. Mol. Diagn., April 1, 2007; 9(2): 158 - 168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Liao, M. Mastali, V. Gau, M. A. Suchard, A. K. Moller, D. A. Bruckner, J. T. Babbitt, Y. Li, J. Gornbein, E. M. Landaw, et al. Use of Electrochemical DNA Biosensors for Rapid Molecular Identification of Uropathogens in Clinical Urine Specimens J. Clin. Microbiol., February 1, 2006; 44(2): 561 - 570. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Inouye, R. Ikeda, M. Takase, T. Tsuri, and J. Chiba Single-nucleotide polymorphism detection with "wire-like" DNA probes that display quasi "on-off" digital action PNAS, August 16, 2005; 102(33): 11606 - 11610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Liu and G. C. Bazan Methods for strand-specific DNA detection with cationic conjugated polymers suitable for incorporation into DNA chips and microarrays PNAS, January 18, 2005; 102(3): 589 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wakai, A. Takagi, M. Nakayama, T. Miya, T. Miyahara, T. Iwanaga, S. Takenaka, Y. Ikeda, and M. Amano A novel method of identifying genetic mutations using an electrochemical DNA array Nucleic Acids Res., October 21, 2004; 32(18): e141 - e141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-E. Navarro, N. Spinelli, C. Moustrou, C. Chaix, B. Mandrand, and H. Brisset Automated synthesis of new ferrocenyl-modified oligonucleotides: study of their properties in solution Nucleic Acids Res., October 5, 2004; 32(17): 5310 - 5319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Koehne, H. Chen, A. M. Cassell, Q. Ye, J. Han, M. Meyyappan, and J. Li Miniaturized Multiplex Label-Free Electronic Chip for Rapid Nucleic Acid Analysis Based on Carbon Nanotube Nanoelectrode Arrays Clin. Chem., October 1, 2004; 50(10): 1886 - 1893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Frusconi, B. Giusti, L. Rossi, S. Bernabini, F. Poggi, I. Giotti, R. Abbate, G. Pepe, and F. Torricelli Improvement of Low-Density Microelectronic Array Technology to Characterize 14 Mutations/Single-Nucleotide Polymorphisms from Several Human Genes on a Large Scale Clin. Chem., April 1, 2004; 50(4): 775 - 777. [Full Text] [PDF]
|
|
|
|
|
|
M. Takahashi, J. Okada, K. Ito, M. Hashimoto, K. Hashimoto, Y. Yoshida, Y. Furuichi, Y. Ohta, S. Mishiro, and N. Gemma Electrochemical DNA Array for Simultaneous Genotyping of Single-Nucleotide Polymorphisms Associated with the Therapeutic Effect of Interferon Clin. Chem., March 1, 2004; 50(3): 658 - 661. [Full Text] [PDF]
|
|
|
|
|
|
C. Fan, K. W. Plaxco, and A. J. Heeger Electrochemical interrogation of conformational changes as a reagentless method for the sequence-specific detection of DNA PNAS, August 5, 2003; 100(16): 9134 - 9137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. S. Gaylord, A. J. Heeger, and G. C. Bazan DNA detection using water-soluble conjugated polymers and peptide nucleic acid probes PNAS, August 20, 2002; 99(17): 10954 - 10957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Wlassoff and G. C. King Ferrocene conjugates of dUTP for enzymatic redox labelling of DNA Nucleic Acids Res., June 15, 2002; 30(12): e58 - e58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. Farkas Bioelectronic DNA Chips for the Clinical Laboratory Clin. Chem., October 1, 2001; 47(10): 1871 - 1872. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK |
