JMD 2000, Vol. 2, No. 3
Copyright © 2000 American Society for Investigative Pathology & Association for Molecular Pathology
Novel Polymorphism in the FMR1 Gene Resulting in a "Pseudodeletion" of FMR1 in a Commonly Used Fragile X Assay
Thomas M. Daly*,
,
Arash Rafii
,
Rick A. Martin
and
Barbara A. Zehnbauer*,,
From the Division of Laboratory Medicine,
*
Department of Pathology,
and the Departments of Surgery
and Pediatrics,
Washington University School of Medicine and St. Louis Children’s Hospital, St. Louis, Missouri
 |
Abstract
|
|---|
The fragile X syndrome is the most commonly inherited cause of
mental retardation. Genetic diagnosis of this disease relies on the
detection of triplet repeat expansion in the FMR1 gene
on the X chromosome. Although the majority of disease in fragile X
patients is due to mutations involving triplet repeat
expansion, deletion of various portions of FMR1
has also been described in association with the fragile X syndrome.
Here we describe a rare polymorphism in the noncoding region of
FMR1 that mimics detection of a deletion in a commonly
used assay for fragile X syndrome, which can result in
misdiagnosis of the disease.
|
Introduction
|
|---|
Fragile X mental retardation is the most common cause of inherited
mental retardation, with an incidence of 1 in 4000 in males and 1 in
6000 in females.1
This syndrome is characterized by mental
retardation coupled with characteristic physical features, such as long
facies, large ears, and macroorchidism.2
At the molecular
level, this disease is associated with expansion of a CGG repeat in the
5' UTR of the FMR1 gene on the X chromosome. This expansion
creates dynamic instability in the FMR1 gene, with the size
of the repeat often increasing in size during female meiosis in
succeeding generations.3
When this expansion reaches a
critical size, hypermethylation of both the repeat and the adjoining
promoter region of FMR1 leads to the decreased transcription
of FMR1. Although the vast majority of patients with fragile
X disease show this pattern of expanded repeats, a small number of
patients have been described in whom partial deletions of
FMR1 result in a disease phenotype.4
Molecular diagnosis of fragile X is based on the demonstration of
expansion of the CGG repeat in patient samples. Traditionally, this
diagnosis was made by cytogenetic detection of the fragile site after
culture of patient cells in medium depleted of folic acid and
thymidine.5
After the discovery of the FMR1
gene and its role in disease, most clinical laboratories adopted
DNA-based strategies to test for fragile X syndrome. These include
methods based on both polymerase chain reaction (PCR) and Southern
analysis of the FMR1 locus. In the genomic Southern
hybridization method of direct mutation testing used in our
laboratory,6
genomic DNA isolated from peripheral white
blood cells of the patient is digested with EcoRI and
SacII (a methylation-sensitive enzyme). This digest is then
probed with an FMR1 fragment (StB12.3)6
to
determine both the methylation status and relative length of the
trinucleotide repeat. A normal male will show a single band of 2.8 kb,
and a normal female will have an additional 5.2-kb band representing
the inactive, methylated allele (Figure 1A)
. Premutations (between 50 and 200 CGG repeats) and full mutations
(>200 copies of the triplet) are detected by increases in the size of
these bands.
View larger version (67K):
[in this window]
[in a new window]
|
Figure 1. Southern analysis of index patient. A: Patient DNA is
digested with EcoRI
(R) and SacII
(S), then probed with the
cloned fragment StB12.3. Normal males generate a 2.8-kb
SacII/EcoRI fragment, whereas normal females
generate an additional 5.2-kb EcoRI/EcoRI
fragment from the methylated allele. Additional restriction sites used
in this paper (HindIII
(H))
are shown. B: Lanes 1–4 show the patterns seen after
digestion with EcoRI/SacII in control patients
with full mutations (MM, mutant male; MF, mutant
female) as compared to normal controls
(NM, normal male; NF, normal
female). Both the index patient
(I) and his brother
(B) show a loss of this
normal pattern and the appearance of smaller bands. The mother
(M) has a more complex
pattern. Digestion with HindIII produces identical bands in
a normal male, the index patient, and his mother. In contrast,
digestion with EcoRI alone demonstrates the presence of a
new EcoRI site in both the index patient and his mother,
when compared to the normal male control.
|
|
In the course of clinical testing in our laboratory, we discovered a
male patient who appeared to have a deletion of the FMR1
gene, as evidenced by the absence of the 2.8-kb band described in the
above assay. Here we describe the work-up of this patient and his
family members and a novel polymorphism that produces this unusual
result.
|
Materials and Methods
|
|---|
Fragile X Analysis
Patient DNA was isolated from anticoagulated peripheral blood with
the "Puregene" DNA isolation procedure (Gentra Systems,
Minneapolis, MN). Five micrograms of genomic DNA was digested with 50 U
each of EcoRI and SacII at 37 degrees for
2 hours. The digested DNA was separated by electrophoresis on a 1.5%
vertical agarose gel (Hoefer Scientific Instruments, San Francisco, CA)
without ethidium bromide for 16 hours at 45 volts. Gels were
subsequently stained with ethidium bromide (EtBr) and photographed to
visualize DNA, followed by alkaline Southern transfer to nylon
membranes (Zeta Probe; Biorad, Hercules, CA). Blots were probed with a
[32P]dCTP-radiolabeled (redivue; Amersham
Pharmacia Biotech, Piscataway, NJ) FMR1 probe (StB12.3)
that hybridizes to the region from bp 14461 to 15537 in
FMR1.
FMR1 PCR
The following PCR primers were designed to bracket regions of the
StB12.3 probe fragment region of FMR1 (numbers
indicate positions in the FMR1 sequence as denoted in
GenBank, reference L29074): FMR1: CCTAAACATCATCTCCCAGCG (14373–14393);
FMR2: TTAGACGCTGAAGCATGTGC (14775–14755); FMR3:
GAGGGAAGGACTGGACTTGG (14153–14173); FMR4: CAGTTGCCATTGTGATTTGG
(14604–14584); FMR5: GTAGTAAGAAGCGGTAGTCG (14562–14582); FMR6:
CCAGCAGTGCATTGAAGAAG (14680–14700); FMR7: CAGCCTTCCTTCCACACGCA
(15240–15220). Final primer concentrations were 0.2 µmol/L each. PCR
was performed using 500 ng of genomic DNA with the
following conditions: 30 cycles of 94°C for 45 seconds, 60°C for 1
minute, 72°C for 90 seconds, with a final extension of 72°C for 5
minutes. After PCR, 10 U of EcoRI was added directly to the
PCR mixture. After a 15-minute incubation at 37°C, reactions were
stopped by adding bromophenyl blue and visualized on a 3% agarose gel.
Sequence Analysis
Direct sequencing of PCR fragments amplified from primers FMR1 and
FMR7 was performed by the Sanger method, using Big Dye fluorescent
sequencing reagents and an ABI 373 analyzer (Applied Biosystems, Foster
City, CA).
EcoRI Screening of Patient Samples
Stored genomic DNA from previous samples submitted to our
laboratory for analysis were anonymously screened using the
PCR/EcoRI digestion protocol described above.
|
Results
|
|---|
Fragile X Analysis of Index Patient Sample by Southern Blot
Analysis
Figure 1B
shows the results of Southern blot analysis of the index
patient and family members, using the StB12.3 probe described above.
After the EcoRI/SacII digestion used for routine
clinical testing in our laboratory, the index patient (I) showed a loss
of the 2.8-kb fragment expected in male subjects, suggesting a deletion
within FMR1 in the area of the StB12.3 probe. (The smaller
bands seen in Figure 1B
were not seen in the original clinical gel.
Presumably these shorter fragments were eluted off the gel, because of
the longer electrophoretic times used in clinical testing to provide
adequate separation of the premutation fragments.) Further analysis of
family members showed that the patient’s brother (B) also had a loss
of the 2.8-kb fragment. The mother (M) of the index patient showed a
more complex abnormal pattern, with two additional bands seen in
addition to the expected 2.8-kb and 5.2-kb fragments.
Because deletions in the FMR1 gene are rare and have
variable fragile X phenotypes, we decided to use additional restriction
enzymes that flank the StB12.3 probe site to determine the extent and
location of the deletion. Surprisingly, digestion with
HindIII (Figure 1B)
and BglII (data not shown)
produced a fragment in the index patient and his mother that was
identical to that seen in normal control samples, indicating that there
was no large-scale deletion in this area of FMR1. This
observation suggested that the "deletion" of the 2.8-kb band seen
in the index patient might be due to a novel EcoRI site in
FMR1. Subsequent analysis showed that digestion with
EcoRI alone produced bands in both the index patient and his
mother that were not seen in normal control patients (Figure 1B)
.
Restriction Fragment Length Polymorphism Analysis of the StB12.3
Fragment
Analysis of the published sequence of the FMR1 gene
revealed six potential sites in the StB12.3 fragment where a single
base change would introduce a new EcoRI site. We constructed
a series of PCR primers to span these areas, amplified each region, and
digested the resulting PCR fragments with EcoRI. PCR
fragments generated from control DNA, using primers FMR1 and FMR7, did
not cut with EcoRI (Figure 2
, lane 2). In contrast, DNA from the index patient generated a PCR
fragment that was cleaved by EcoRI into two smaller
fragments (Figure 2
, lane 4). Genomic DNA isolated from the mother of
this patient showed that she was heterozygous for this mutation (lane
6), and a brother also carried the mutation (data not shown). Sequence
analysis of this region confirmed that an A 
G transition at
position 14744 had produced a new EcoRI site in both the
index patient and his mother (Figure 3)
. No other novel EcoRI sites were detected using the other
FMR primer combinations.
View larger version (127K):
[in this window]
[in a new window]
|
Figure 2. PCR-restriction fragment length polymorphism analysis for an
EcoRI site. Genomic DNA was amplified using primers FMR1
and FMR7 to produce a 867-bp fragment spanning bases 14373 to 15240 in
the FMR1 gene. Lanes marked + have been digested with
EcoRI. PCR using control DNA from a normal subject
produces a fragment that does not cut with EcoRI.
Digestion of the PCR product from the index patient’s DNA produces
fragments of 371 and 496 bp. DNA from the mother shows that she is
heterozygous for the EcoRI site.
|
|
View larger version (143K):
[in this window]
[in a new window]
|
Figure 3. Sequence analysis of patient DNA. The PCR fragment amplified using
primers FMR5 and FMR7 was sequenced from both the index patient and his
mother. Patient DNA shows an A G transition at bp 14744. The mother
is heterozygous for this mutation.
|
|
Frequency of Polymorphism
Because this polymorphism has not previously been reported, we
used the PCR/EcoRI assay to rapidly screen DNA samples from
our patient stores to estimate the prevalence of this polymorphism in
the general population. Seventy-two patient samples (40 male, 32
female, 104 chromosomes) were analyzed by PCR restriction fragment
length polymorphism analysis. No additional examples of this
polymorphism were found, suggesting that the frequency of this
polymorphism in the general population is less than 1%. In addition, a
retrospective review of more than 900 fragile X assays performed in our
laboratory over the past 5 years with the
EcoRI-SacII genomic Southern hybridization
protocol revealed no evidence of similar "pseudodeletions" in past
testing.
|
Conclusions
|
|---|
We have described a novel polymorphism in the FMR1
gene, where an A G transition produces a new EcoRI site.
For the diagnostic method discussed here, the presence of this
polymorphism results in cleavage of the normal unmethylated 2.8-kb
fragment into two smaller fragments of 1.6 and 1.2 kb. These smaller
fragments may run off the gel under the conditions used for clinical
testing, as gels are run for prolonged periods on high-percentage
agarose to optimize separation of the larger fragments
necessary for detection of premutations. The loss of the normal 2.8-kb
band or the presence of smaller fragments generated by this new
EcoRI site can give the appearance of a deletion in
FMR1, as was seen in this case.
It is not clear whether this polymorphism has functional significance
for the mental retardation phenotype. The mutation is located outside
both the coding and promoter regions of FMR1 and does not
appear to produce a new splice site. However, it is interesting to note
that the mother shows preferential methylation of the mutant allele, as
evidenced by the pattern seen with Southern analysis after the
EcoRI/SacII digestion. The presence of four bands
in the mother’s sample is consistent with heterozygosity for the
mutation, and comparison of the fragments generated from the maternal
allele without the polymorphism shows that the 5.2-kb fragment
(methylated allele) is much less intense than the 2.8-kb fragment
(unmethylated allele), suggesting a skewed pattern of X chromosome
inactivation. However, it is not clear whether this shift in
methylation is associated with the polymorphism or is a separate
phenomenon.
For the purposes of clinical diagnostic testing, this patient did not
have a triplet repeat expansion typically associated with clinical
symptoms of the fragile X syndrome. The final report for the patient
described in this study was "Triplet repeat expansion not
detected," and consultation with the ordering physician was provided
to describe the results more fully. Although the direct phenotypic
influence(s) of this unusual polymorphism with respect to the fragile X
syndrome is unknown, from a diagnostic standpoint, this newly described
polymorphism can affect the ability of laboratories to correctly
diagnose clinical samples. Laboratories that use the method of
detection described here could incorrectly identify the patient as
having a deletion of part of the FMR1 gene. Because the
deletions of FMR1 that have been described show variable
association with the mental retardation phenotype, misclassification of
a patient as carrying a FMR1 deletion could result in the
misdiagnosis of a genetic basis for the patient’s mental retardation.
|
Footnotes
|
|---|
Address reprint requests to Dr. Barbara A. Zehnbauer, Molecular Diagnostics Laboratory, Box 8118, 660 S. Euclid Ave., Washington University School of Medicine, St. Louis, MO 63110. E-mail: zehnbauer_b{at}kids.wustl.edu
Accepted for publication May 30, 2000.
|
References
|
|---|
-
Turner G, Webb T, Wake S, Robinson H: Prevalence of fragile X syndrome. Am J Med Genet 1996, 64:196-197[Medline]
-
de Vries BBA, Halley DJ, Oostra BA, Niermeijer MF: The fragile X syndrome. J Med Genet 1998, 35:579-589[Abstract/Free Full Text]
-
Oberle I, Rousseau F, Heitz D, Kretz C, Devys D, Hanauer A, Boue J, Bertheas MF, Mandel JL: Instability of a 550-base pair DNA fragment and abnormal methylation in fragile X syndrome. Science 1991, 252:1097-1102[Medline]
-
Hammond LS, Macias MM, Tarleton JC, Pai GS: Fragile X syndrome and deletions in FMR1: new case and review of the literature. Am J Med Genet 1997, 72:430-434[Medline]
-
Sutherland GR: Heritable fragile sites on human chromosome. I. Factors affecting expression in lymphocyte culture Am J Hum Genet 1979, 31:125-135[Medline]
-
Rousseau F, Heitz D, Biancalana V, Blumenfeld S, Kretz C, Boue J, Tommerup N, Van Der Hagen C, DeLozier-Blanchet C, Croquette M-F, Gilgenkrantz S, Jalbert P, Voelckel M-A, Oberle I, Mandel J-L: Direct diagnosis by DNA analysis of the fragile X syndrome of mental retardation. N Engl J Med 1991, 325:1673-1681[Abstract]
This article has been cited by other articles:
|
|
|
|
 
S. Liang, H. N. Bass, H. Gao, C. Astbury, M. R. Jamehdor, and Y. Qu
A Pseudo-Full Mutation Identified in Fragile X Assay Reveals a Novel Base Change Abolishing an EcoRI Restriction Site
J. Mol. Diagn.,
September 1, 2008;
10(5):
469 - 474.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Cecconi, F. Forzano, R. Rinaldi, S. Cappellacci, P. Grammatico, F. Faravelli, F. Dagna Bricarelli, E. Di Maria, and M. Grasso
A Single Nucleotide Variant in the FMR1 CGG Repeat Results in a "Pseudodeletion" and Is Not Associated with the Fragile X Syndrome Phenotype
J. Mol. Diagn.,
May 1, 2008;
10(3):
272 - 275.
[Abstract]
[Full Text]
[PDF]
|
|
|
Top
Abstract
Introduction
